Incidental Mutation 'R0294:Il5ra'
ID 26285
Institutional Source Beutler Lab
Gene Symbol Il5ra
Ensembl Gene ENSMUSG00000005364
Gene Name interleukin 5 receptor, alpha
Synonyms CDw125, IL-5 receptor alpha chain, CD125, Il5r
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0294 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 106710357-106749037 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106712401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 410 (M410K)
Ref Sequence ENSEMBL: ENSMUSP00000144718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167925] [ENSMUST00000204659] [ENSMUST00000205004]
AlphaFold P21183
Predicted Effect probably benign
Transcript: ENSMUST00000167925
AA Change: M410K

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129781
Gene: ENSMUSG00000005364
AA Change: M410K

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204659
AA Change: M410K

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144718
Gene: ENSMUSG00000005364
AA Change: M410K

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205004
AA Change: W65R
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but with some immune system deficiencies. Mice homozygous for one knock-out allele exhibit increased metastasis of injected B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Il5ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Il5ra APN 6 106712474 splice site probably benign
IGL00726:Il5ra APN 6 106738489 missense probably damaging 1.00
IGL01095:Il5ra APN 6 106742644 intron probably benign
IGL01562:Il5ra APN 6 106731904 missense probably benign 0.00
IGL01569:Il5ra APN 6 106731833 start codon destroyed probably null
IGL02346:Il5ra APN 6 106742658 missense probably benign 0.02
IGL02573:Il5ra APN 6 106716751 missense possibly damaging 0.93
IGL02659:Il5ra APN 6 106742683 missense possibly damaging 0.49
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0463:Il5ra UTSW 6 106731890 missense probably damaging 0.99
R0478:Il5ra UTSW 6 106738462 missense probably benign
R0597:Il5ra UTSW 6 106744335 start codon destroyed probably null 0.99
R1526:Il5ra UTSW 6 106735820 missense possibly damaging 0.49
R1695:Il5ra UTSW 6 106738374 nonsense probably null
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R2176:Il5ra UTSW 6 106738272 missense probably benign
R2207:Il5ra UTSW 6 106712441 nonsense probably null
R2973:Il5ra UTSW 6 106741235 missense probably benign 0.08
R4546:Il5ra UTSW 6 106738498 nonsense probably null
R4842:Il5ra UTSW 6 106738375 missense probably damaging 1.00
R4851:Il5ra UTSW 6 106738471 missense probably benign 0.06
R4911:Il5ra UTSW 6 106715668 missense probably damaging 1.00
R4936:Il5ra UTSW 6 106738162 missense possibly damaging 0.90
R5297:Il5ra UTSW 6 106738134 missense probably benign 0.09
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R8103:Il5ra UTSW 6 106715650 missense possibly damaging 0.87
R8338:Il5ra UTSW 6 106712389 missense probably benign 0.09
R8497:Il5ra UTSW 6 106738105 missense probably benign 0.01
R8936:Il5ra UTSW 6 106715643 missense possibly damaging 0.94
R9397:Il5ra UTSW 6 106744297 missense probably benign 0.10
R9576:Il5ra UTSW 6 106735727 missense probably damaging 1.00
R9583:Il5ra UTSW 6 106712370 missense unknown
R9583:Il5ra UTSW 6 106744336 start codon destroyed possibly damaging 0.84
Z1177:Il5ra UTSW 6 106741134 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGGACATTGGTGACTCATGTCTG -3'
(R):5'- GGCTAGGGCAATATATCTCAATGGCAG -3'

Sequencing Primer
(F):5'- cctcgaactcagaaatcctcc -3'
(R):5'- CAAACCAACTGTGaaaaaaacaaaag -3'
Posted On 2013-04-16