Incidental Mutation 'R3103:Svs5'
ID 262884
Institutional Source Beutler Lab
Gene Symbol Svs5
Ensembl Gene ENSMUSG00000017004
Gene Name seminal vesicle secretory protein 5
Synonyms seminal vesicle protein F, Svp-1, Svp1, SVS V, Svp5
MMRRC Submission 040577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R3103 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164174685-164176314 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 164175313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 55 (E55V)
Ref Sequence ENSEMBL: ENSMUSP00000017148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017148]
AlphaFold P30933
Predicted Effect probably benign
Transcript: ENSMUST00000017148
AA Change: E55V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000017148
Gene: ENSMUSG00000017004
AA Change: E55V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149370
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,310,409 (GRCm39) probably null Het
Adap2 G T 11: 80,047,859 (GRCm39) C105F probably damaging Het
Bace2 T C 16: 97,223,201 (GRCm39) probably null Het
Bpifc A G 10: 85,829,286 (GRCm39) S94P probably damaging Het
C2cd3 A G 7: 100,044,459 (GRCm39) D347G possibly damaging Het
Cad T C 5: 31,219,018 (GRCm39) V613A possibly damaging Het
Ccdc47 T C 11: 106,093,667 (GRCm39) H6R probably benign Het
Celsr3 A G 9: 108,714,338 (GRCm39) T1956A probably benign Het
Cep128 T A 12: 90,986,118 (GRCm39) D1006V probably damaging Het
Cog3 T C 14: 75,984,641 (GRCm39) probably null Het
Csmd1 C T 8: 15,967,405 (GRCm39) V3153M probably damaging Het
Ctnna2 T C 6: 77,630,127 (GRCm39) E122G possibly damaging Het
Cts8 T A 13: 61,398,772 (GRCm39) I245F probably damaging Het
Ddx27 T A 2: 166,868,166 (GRCm39) V333E probably damaging Het
Dmpk A G 7: 18,821,579 (GRCm39) Y279C probably damaging Het
Dpagt1 A G 9: 44,239,292 (GRCm39) I111V probably benign Het
Dvl2 C A 11: 69,899,695 (GRCm39) P546T possibly damaging Het
Fat4 G T 3: 38,946,089 (GRCm39) A1661S probably benign Het
Gcm1 A G 9: 77,971,734 (GRCm39) N225S probably damaging Het
Gcnt2 A T 13: 41,072,082 (GRCm39) M242L probably benign Het
Golgb1 A G 16: 36,715,211 (GRCm39) R226G probably damaging Het
Gpr63 G A 4: 25,007,353 (GRCm39) V26I probably benign Het
Grik2 A G 10: 49,116,868 (GRCm39) L631P probably damaging Het
Hapln3 T C 7: 78,771,484 (GRCm39) D135G probably benign Het
Il31ra C A 13: 112,666,885 (GRCm39) V398F probably damaging Het
Ipp G T 4: 116,381,446 (GRCm39) R315L possibly damaging Het
Kcmf1 A G 6: 72,838,830 (GRCm39) L32P probably damaging Het
Klf17 T A 4: 117,617,805 (GRCm39) Q184L possibly damaging Het
Lrp2 C T 2: 69,262,328 (GRCm39) V4442I probably benign Het
Lrrfip2 A T 9: 111,051,278 (GRCm39) E293D probably damaging Het
Oit3 A G 10: 59,274,713 (GRCm39) I29T probably damaging Het
Or1a1 G A 11: 74,086,901 (GRCm39) D191N probably benign Het
Or1j21 T C 2: 36,683,574 (GRCm39) C109R possibly damaging Het
Or51h1 T C 7: 102,308,688 (GRCm39) V220A probably benign Het
Plb1 T A 5: 32,485,373 (GRCm39) M842K possibly damaging Het
Ppt1 T C 4: 122,730,100 (GRCm39) C18R probably benign Het
Pstpip2 T C 18: 77,959,477 (GRCm39) Y191H probably damaging Het
Ryr1 C T 7: 28,774,373 (GRCm39) V2361I probably damaging Het
Serpinb11 A G 1: 107,305,338 (GRCm39) N238S probably benign Het
Skor2 A T 18: 76,946,973 (GRCm39) K232* probably null Het
Slc13a5 A T 11: 72,148,214 (GRCm39) W231R probably damaging Het
Tfcp2 A T 15: 100,423,481 (GRCm39) W142R probably damaging Het
Trpc2 A T 7: 101,744,441 (GRCm39) I738F possibly damaging Het
Vmn2r61 T A 7: 41,916,067 (GRCm39) S227T possibly damaging Het
Zfhx4 A G 3: 5,464,386 (GRCm39) T1540A probably damaging Het
Zfp616 A G 11: 73,962,561 (GRCm39) T74A probably benign Het
Other mutations in Svs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs5 APN 2 164,078,962 (GRCm39) missense possibly damaging 0.86
IGL01722:Svs5 APN 2 164,079,446 (GRCm39) missense possibly damaging 0.71
IGL03189:Svs5 APN 2 164,079,032 (GRCm39) missense possibly damaging 0.73
IGL03378:Svs5 APN 2 164,175,260 (GRCm39) missense probably benign 0.00
R0781:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1110:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1276:Svs5 UTSW 2 164,079,168 (GRCm39) missense possibly damaging 0.95
R1541:Svs5 UTSW 2 164,078,929 (GRCm39) missense possibly damaging 0.71
R1590:Svs5 UTSW 2 164,079,578 (GRCm39) missense possibly damaging 0.86
R3946:Svs5 UTSW 2 164,079,047 (GRCm39) missense probably benign 0.01
R3965:Svs5 UTSW 2 164,079,662 (GRCm39) missense possibly damaging 0.53
R4075:Svs5 UTSW 2 164,079,238 (GRCm39) missense probably benign 0.01
R4632:Svs5 UTSW 2 164,079,667 (GRCm39) missense probably benign 0.40
R4732:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4733:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4839:Svs5 UTSW 2 164,078,806 (GRCm39) missense probably benign 0.40
R5706:Svs5 UTSW 2 164,079,589 (GRCm39) missense possibly damaging 0.53
R6936:Svs5 UTSW 2 164,079,548 (GRCm39) missense possibly damaging 0.86
R7052:Svs5 UTSW 2 164,080,126 (GRCm39) missense unknown
R7338:Svs5 UTSW 2 164,174,728 (GRCm39) missense possibly damaging 0.96
R7836:Svs5 UTSW 2 164,079,500 (GRCm39) missense possibly damaging 0.86
R8017:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8019:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8035:Svs5 UTSW 2 164,079,053 (GRCm39) missense probably benign 0.18
R8100:Svs5 UTSW 2 164,079,712 (GRCm39) missense probably benign 0.08
R8187:Svs5 UTSW 2 164,079,692 (GRCm39) missense possibly damaging 0.88
R8310:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R8312:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R9089:Svs5 UTSW 2 164,079,341 (GRCm39) missense probably benign 0.27
R9156:Svs5 UTSW 2 164,079,509 (GRCm39) missense probably benign 0.32
R9545:Svs5 UTSW 2 164,079,313 (GRCm39) missense possibly damaging 0.52
R9790:Svs5 UTSW 2 164,078,918 (GRCm39) nonsense probably null
R9791:Svs5 UTSW 2 164,078,918 (GRCm39) nonsense probably null
Z1176:Svs5 UTSW 2 164,174,711 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGTCCTGATGCACCACTGAC -3'
(R):5'- TCTAGTCTTCAGATGGCCAGG -3'

Sequencing Primer
(F):5'- TGATGCACCACTGACCCAGAG -3'
(R):5'- CCAGGGAACACGTTATTTGAGTATCC -3'
Posted On 2015-02-05