Incidental Mutation 'R3103:Ipp'
ID262889
Institutional Source Beutler Lab
Gene Symbol Ipp
Ensembl Gene ENSMUSG00000028696
Gene NameIAP promoted placental gene
SynonymsD4Jhu8, Mipp
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116507549-116538243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116524249 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 315 (R315L)
Ref Sequence ENSEMBL: ENSMUSP00000102088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030461] [ENSMUST00000106479]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030461
AA Change: R315L

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030461
Gene: ENSMUSG00000028696
AA Change: R315L

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106479
AA Change: R315L

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102088
Gene: ENSMUSG00000028696
AA Change: R315L

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Ipp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ipp APN 4 116532659 missense possibly damaging 0.93
IGL01399:Ipp APN 4 116515187 missense probably damaging 1.00
IGL01934:Ipp APN 4 116510655 missense probably damaging 0.99
IGL02805:Ipp APN 4 116529688 missense possibly damaging 0.92
Iguacu UTSW 4 116537938 nonsense probably null
R0582:Ipp UTSW 4 116515467 missense probably damaging 1.00
R0669:Ipp UTSW 4 116537876 missense probably damaging 1.00
R1121:Ipp UTSW 4 116520675 missense probably benign 0.00
R1394:Ipp UTSW 4 116537912 nonsense probably null
R1738:Ipp UTSW 4 116530421 missense probably benign 0.00
R2021:Ipp UTSW 4 116515368 missense probably benign 0.26
R4372:Ipp UTSW 4 116515363 missense possibly damaging 0.90
R4439:Ipp UTSW 4 116515077 missense probably benign 0.00
R4571:Ipp UTSW 4 116530458 missense probably damaging 1.00
R5134:Ipp UTSW 4 116515457 missense possibly damaging 0.65
R5503:Ipp UTSW 4 116537938 nonsense probably null
R5519:Ipp UTSW 4 116510767 missense possibly damaging 0.76
R5640:Ipp UTSW 4 116520689 missense possibly damaging 0.67
R5768:Ipp UTSW 4 116510770 missense probably damaging 1.00
R6867:Ipp UTSW 4 116510409 splice site probably null
R7575:Ipp UTSW 4 116532644 missense probably benign 0.20
R7851:Ipp UTSW 4 116515475 nonsense probably null
R7992:Ipp UTSW 4 116524256 missense probably damaging 1.00
R8069:Ipp UTSW 4 116510856 missense probably benign 0.11
Z1176:Ipp UTSW 4 116537885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTTTATAGAGGTGACAGTCTC -3'
(R):5'- AGTGAAGATGGTCAAGCACATTAC -3'

Sequencing Primer
(F):5'- TTATAGAGGTGACAGTCTCTAAGC -3'
(R):5'- TGGTCAAGCACATTACACAGTTGC -3'
Posted On2015-02-05