Incidental Mutation 'R0294:Olfr506'
ID26289
Institutional Source Beutler Lab
Gene Symbol Olfr506
Ensembl Gene ENSMUSG00000058244
Gene Nameolfactory receptor 506
SynonymsGA_x6K02T2PBJ9-10942040-10942984, MOR204-23
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108610787-108615340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108613150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 281 (Y281F)
Ref Sequence ENSEMBL: ENSMUSP00000147623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077343] [ENSMUST00000209296]
Predicted Effect probably damaging
Transcript: ENSMUST00000077343
AA Change: Y281F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076566
Gene: ENSMUSG00000058244
AA Change: Y281F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1e-53 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209296
AA Change: Y281F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Olfr506
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Olfr506 APN 7 108613054 missense probably damaging 0.97
IGL02480:Olfr506 APN 7 108612811 missense probably benign
IGL02802:Olfr506 UTSW 7 108612462 missense probably damaging 0.99
R0398:Olfr506 UTSW 7 108612955 missense probably benign 0.30
R0452:Olfr506 UTSW 7 108612370 missense possibly damaging 0.62
R3788:Olfr506 UTSW 7 108613073 nonsense probably null
R7065:Olfr506 UTSW 7 108613059 missense probably damaging 0.99
R7345:Olfr506 UTSW 7 108613063 missense probably benign 0.11
R7671:Olfr506 UTSW 7 108612991 missense probably damaging 1.00
R8270:Olfr506 UTSW 7 108612943 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCATCCTGAAGATGCACTCCACTG -3'
(R):5'- TGCCTCTGGTAAACTAAAGATTGCCC -3'

Sequencing Primer
(F):5'- ATGCACTCCACTGAGGGC -3'
(R):5'- GACCTTAACAAACTCTTTGGGAACAG -3'
Posted On2013-04-16