Incidental Mutation 'R3103:Dmpk'
ID262896
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 040577-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19087654 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000118459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably damaging
Transcript: ENSMUST00000032568
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108473
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108474
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect probably damaging
Transcript: ENSMUST00000154199
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
R8234:Dmpk UTSW 7 19088123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTGATTGGCACAGGTGAG -3'
(R):5'- CAGCGACAAGTGTTCCTATTTAG -3'

Sequencing Primer
(F):5'- TTGGCACAGGTGAGGTCGC -3'
(R):5'- AATAGTCTGTGACTCCAGTTCCAGG -3'
Posted On2015-02-05