Mutagenetix > Incidental Mutation

Incidental Mutation 'R3103:Acp7'

262897

Institutional Source

Beutler Lab

Gene Symbol

Acp7

Ensembl Gene

ENSMUSG00000037469

Gene Name

acid phosphatase 7, tartrate resistant

Synonyms

Papl, C330005M16Rik

MMRRC Submission

040577-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R3103 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28607634-28631332 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 28610984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040112]

AlphaFold

Q8BX37

Predicted Effect

probably null
Transcript: ENSMUST00000040112

SMART Domains

Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469

Domain	Start	End	E-Value	Type
Pfam:Pur_ac_phosph_N	90	183	2.2e-19	PFAM
Pfam:Metallophos	192	395	6.4e-27	PFAM
Pfam:Metallophos_C	420	482	4.5e-22	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap2	G	T	11: 80,157,033	C105F	probably damaging	Het
Bace2	T	C	16: 97,422,001		probably null	Het
Bpifc	A	G	10: 85,993,422	S94P	probably damaging	Het
C2cd3	A	G	7: 100,395,252	D347G	possibly damaging	Het
Cad	T	C	5: 31,061,674	V613A	possibly damaging	Het
Ccdc47	T	C	11: 106,202,841	H6R	probably benign	Het
Celsr3	A	G	9: 108,837,139	T1956A	probably benign	Het
Cep128	T	A	12: 91,019,344	D1006V	probably damaging	Het
Cog3	T	C	14: 75,747,201		probably null	Het
Csmd1	C	T	8: 15,917,405	V3153M	probably damaging	Het
Ctnna2	T	C	6: 77,653,144	E122G	possibly damaging	Het
Cts8	T	A	13: 61,250,958	I245F	probably damaging	Het
Ddx27	T	A	2: 167,026,246	V333E	probably damaging	Het
Dmpk	A	G	7: 19,087,654	Y279C	probably damaging	Het
Dpagt1	A	G	9: 44,327,995	I111V	probably benign	Het
Dvl2	C	A	11: 70,008,869	P546T	possibly damaging	Het
Fat4	G	T	3: 38,891,940	A1661S	probably benign	Het
Gcm1	A	G	9: 78,064,452	N225S	probably damaging	Het
Gcnt2	A	T	13: 40,918,606	M242L	probably benign	Het
Golgb1	A	G	16: 36,894,849	R226G	probably damaging	Het
Gpr63	G	A	4: 25,007,353	V26I	probably benign	Het
Grik2	A	G	10: 49,240,772	L631P	probably damaging	Het
Hapln3	T	C	7: 79,121,736	D135G	probably benign	Het
Il31ra	C	A	13: 112,530,351	V398F	probably damaging	Het
Ipp	G	T	4: 116,524,249	R315L	possibly damaging	Het
Kcmf1	A	G	6: 72,861,847	L32P	probably damaging	Het
Klf17	T	A	4: 117,760,608	Q184L	possibly damaging	Het
Lrp2	C	T	2: 69,431,984	V4442I	probably benign	Het
Lrrfip2	A	T	9: 111,222,210	E293D	probably damaging	Het
Oit3	A	G	10: 59,438,891	I29T	probably damaging	Het
Olfr403	G	A	11: 74,196,075	D191N	probably benign	Het
Olfr50	T	C	2: 36,793,562	C109R	possibly damaging	Het
Olfr555	T	C	7: 102,659,481	V220A	probably benign	Het
Plb1	T	A	5: 32,328,029	M842K	possibly damaging	Het
Ppt1	T	C	4: 122,836,307	C18R	probably benign	Het
Pstpip2	T	C	18: 77,871,777	Y191H	probably damaging	Het
Ryr1	C	T	7: 29,074,948	V2361I	probably damaging	Het
Serpinb11	A	G	1: 107,377,608	N238S	probably benign	Het
Skor2	A	T	18: 76,859,278	K232*	probably null	Het
Slc13a5	A	T	11: 72,257,388	W231R	probably damaging	Het
Svs5	A	T	2: 164,333,393	E55V	probably benign	Het
Tfcp2	A	T	15: 100,525,600	W142R	probably damaging	Het
Trpc2	A	T	7: 102,095,234	I738F	possibly damaging	Het
Vmn2r61	T	A	7: 42,266,643	S227T	possibly damaging	Het
Zfhx4	A	G	3: 5,399,326	T1540A	probably damaging	Het
Zfp616	A	G	11: 74,071,735	T74A	probably benign	Het

Other mutations in Acp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Acp7	APN	7	28614697	missense	possibly damaging	0.79
IGL00808:Acp7	APN	7	28614952	missense	probably damaging	1.00
IGL01085:Acp7	APN	7	28611053	missense	probably damaging	1.00
IGL02123:Acp7	APN	7	28629489	missense	probably benign
IGL02250:Acp7	APN	7	28629710	splice site	probably benign
IGL02255:Acp7	APN	7	28614723	missense	probably damaging	1.00
IGL02904:Acp7	APN	7	28608003	missense	probably benign	0.11
IGL03110:Acp7	APN	7	28611039	missense	probably benign	0.25
R0172:Acp7	UTSW	7	28615124	missense	possibly damaging	0.95
R0360:Acp7	UTSW	7	28611128	splice site	probably benign
R0364:Acp7	UTSW	7	28611128	splice site	probably benign
R1616:Acp7	UTSW	7	28611078	missense	probably damaging	1.00
R1973:Acp7	UTSW	7	28607989	missense	probably damaging	1.00
R2077:Acp7	UTSW	7	28629482	missense	probably damaging	1.00
R2125:Acp7	UTSW	7	28629549	missense	probably damaging	0.99
R2256:Acp7	UTSW	7	28614413	missense	probably damaging	0.98
R2257:Acp7	UTSW	7	28614413	missense	probably damaging	0.98
R2696:Acp7	UTSW	7	28614576	missense	probably benign	0.00
R3753:Acp7	UTSW	7	28616660	missense	probably damaging	1.00
R3833:Acp7	UTSW	7	28615094	missense	probably benign	0.00
R4622:Acp7	UTSW	7	28614397	missense	probably damaging	1.00
R4849:Acp7	UTSW	7	28615452	missense	possibly damaging	0.82
R5364:Acp7	UTSW	7	28611023	missense	probably benign	0.25
R5382:Acp7	UTSW	7	28615419	missense	possibly damaging	0.80
R5665:Acp7	UTSW	7	28616543	missense	probably benign	0.31
R5688:Acp7	UTSW	7	28616495	missense	probably benign	0.20
R7278:Acp7	UTSW	7	28630882	missense	unknown
R7295:Acp7	UTSW	7	28629530	missense	possibly damaging	0.83
R7384:Acp7	UTSW	7	28615088	missense	possibly damaging	0.89
R7875:Acp7	UTSW	7	28614727	missense	probably damaging	1.00
R8227:Acp7	UTSW	7	28616648	missense	probably damaging	1.00
R8772:Acp7	UTSW	7	28616484	missense	probably damaging	0.99
R8969:Acp7	UTSW	7	28607957	missense	probably damaging	1.00
R9053:Acp7	UTSW	7	28617191	missense	possibly damaging	0.81
R9199:Acp7	UTSW	7	28617166	missense	probably benign	0.45
RF006:Acp7	UTSW	7	28614779	missense	possibly damaging	0.94
X0018:Acp7	UTSW	7	28607981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACCCAGTTGGCCTTGAAGTG -3'
(R):5'- CGCACTTGTCTGACTGTCTG -3'

Sequencing Primer
(F):5'- AGGGGCTCTACCATTAAGCCATG -3'
(R):5'- GTCTGACTGTCTGTCCTCCAC -3'

Posted On

2015-02-05