Incidental Mutation 'R3103:Vmn2r61'
ID262899
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42266643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 227 (S227T)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166131
AA Change: S227T

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: S227T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206855
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R8026:Vmn2r61 UTSW 7 42266717 missense probably benign 0.02
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTGGGAATTTGTCTTATGCC -3'
(R):5'- ACAGTTGTGCAATATGTCGC -3'

Sequencing Primer
(F):5'- GATATCTCTTCAGCTAACTTTTGGAC -3'
(R):5'- GTTGTGCAATATGTCGCATTAAACC -3'
Posted On2015-02-05