Incidental Mutation 'R3103:Hapln3'
ID262900
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Namehyaluronan and proteoglycan link protein 3
SynonymsLpr3, 4930554N11Rik
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79115102-79131018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79121736 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 135 (D135G)
Ref Sequence ENSEMBL: ENSMUSP00000145726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000205782] [ENSMUST00000206092]
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205782
AA Change: D135G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206092
AA Change: D135G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206402
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 intron probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R5625:Hapln3 UTSW 7 79117258 unclassified probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGAACCAGCTCCCATTTC -3'
(R):5'- ATCCCCAAGACATGTGCGTG -3'

Sequencing Primer
(F):5'- GGAAGTTGCTCCCTGAGTTCAAAC -3'
(R):5'- CCCCAAGACATGTGCGTGTTAAG -3'
Posted On2015-02-05