Incidental Mutation 'R3103:Olfr555'
ID262903
Institutional Source Beutler Lab
Gene Symbol Olfr555
Ensembl Gene ENSMUSG00000073970
Gene Nameolfactory receptor 555
SynonymsMOR10-1, GA_x6K02T2PBJ9-5375442-5376389
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102658823-102659770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102659481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000095823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098220]
Predicted Effect probably benign
Transcript: ENSMUST00000098220
AA Change: V220A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095823
Gene: ENSMUSG00000073970
AA Change: V220A

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-126 PFAM
Pfam:7TM_GPCR_Srsx 36 308 1.7e-7 PFAM
Pfam:7tm_1 42 293 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Olfr555
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr555 APN 7 102659348 missense probably damaging 0.98
IGL01150:Olfr555 APN 7 102659492 missense probably benign 0.00
IGL02610:Olfr555 APN 7 102659567 missense probably benign 0.41
IGL02679:Olfr555 APN 7 102659177 missense possibly damaging 0.55
R0332:Olfr555 UTSW 7 102659465 missense probably damaging 0.99
R1493:Olfr555 UTSW 7 102659013 missense probably damaging 1.00
R1631:Olfr555 UTSW 7 102659201 missense probably damaging 1.00
R1682:Olfr555 UTSW 7 102659697 missense probably damaging 0.96
R3026:Olfr555 UTSW 7 102659129 missense possibly damaging 0.90
R4592:Olfr555 UTSW 7 102659478 missense probably damaging 0.99
R4782:Olfr555 UTSW 7 102658834 missense possibly damaging 0.63
R6282:Olfr555 UTSW 7 102659647 missense probably benign 0.00
R7571:Olfr555 UTSW 7 102659051 missense probably damaging 1.00
R8001:Olfr555 UTSW 7 102659034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACGGCTGCCCTTCTGTC -3'
(R):5'- TGTCTTCACACTGTAGACAATAGGG -3'

Sequencing Primer
(F):5'- GCCCTTCTGTCGTTCCAATG -3'
(R):5'- CACACTGTAGACAATAGGGTTTAGC -3'
Posted On2015-02-05