Incidental Mutation 'R3103:Gcm1'
ID262908
Institutional Source Beutler Lab
Gene Symbol Gcm1
Ensembl Gene ENSMUSG00000023333
Gene Nameglial cells missing homolog 1
Synonymsglide, GCMa, Gcm a, Gcm 1, Gcm1-rs1, glial cell deficient
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location78051924-78065624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78064452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 225 (N225S)
Ref Sequence ENSEMBL: ENSMUSP00000024104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024104]
PDB Structure
STRUCTURE OF THE GCM DOMAIN BOUND TO DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000024104
AA Change: N225S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024104
Gene: ENSMUSG00000023333
AA Change: N225S

DomainStartEndE-ValueType
Pfam:GCM 30 167 4.2e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217247
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired branching of the chorioallantoic interface, absence of the placental labyrinth, lack of fusion of chorionic trophoblast cells, and lethality between embryonic days 5.5-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Gcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Gcm1 APN 9 78065016 missense probably benign 0.09
IGL02132:Gcm1 APN 9 78064839 missense possibly damaging 0.95
IGL02820:Gcm1 APN 9 78064562 missense probably benign
IGL03074:Gcm1 APN 9 78064775 missense possibly damaging 0.84
PIT4280001:Gcm1 UTSW 9 78059633 missense probably damaging 1.00
R0720:Gcm1 UTSW 9 78064641 missense possibly damaging 0.68
R1271:Gcm1 UTSW 9 78059577 missense probably benign 0.05
R1421:Gcm1 UTSW 9 78059700 missense probably damaging 1.00
R1481:Gcm1 UTSW 9 78059717 nonsense probably null
R1884:Gcm1 UTSW 9 78059579 missense probably benign 0.01
R1907:Gcm1 UTSW 9 78064773 missense probably benign 0.00
R2029:Gcm1 UTSW 9 78065044 missense possibly damaging 0.70
R2160:Gcm1 UTSW 9 78061380 missense probably benign 0.05
R3944:Gcm1 UTSW 9 78059816 nonsense probably null
R5292:Gcm1 UTSW 9 78061426 missense probably damaging 1.00
R5769:Gcm1 UTSW 9 78064967 missense probably benign
R6446:Gcm1 UTSW 9 78059783 missense probably benign 0.08
R6465:Gcm1 UTSW 9 78064869 missense probably damaging 0.99
R7114:Gcm1 UTSW 9 78059779 missense probably damaging 1.00
R7212:Gcm1 UTSW 9 78059643 missense possibly damaging 0.84
R7398:Gcm1 UTSW 9 78064679 missense probably benign 0.00
R7584:Gcm1 UTSW 9 78064467 missense possibly damaging 0.62
R8130:Gcm1 UTSW 9 78064534 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGAATAACTCAGGGGTGC -3'
(R):5'- AAGTTTGCAGGTCTTCGTAGTCTC -3'

Sequencing Primer
(F):5'- TGCCTGGGGTAGCCATG -3'
(R):5'- TAGTCTCCATACGTCCCAGGG -3'
Posted On2015-02-05