Incidental Mutation 'R3103:Lrrfip2'
ID262910
Institutional Source Beutler Lab
Gene Symbol Lrrfip2
Ensembl Gene ENSMUSG00000032497
Gene Nameleucine rich repeat (in FLII) interacting protein 2
Synonyms
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111117592-111225668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111222210 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 293 (E293D)
Ref Sequence ENSEMBL: ENSMUSP00000151145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000098340] [ENSMUST00000196981] [ENSMUST00000197241] [ENSMUST00000197256] [ENSMUST00000216430] [ENSMUST00000217117] [ENSMUST00000217341]
Predicted Effect probably damaging
Transcript: ENSMUST00000035078
AA Change: E335D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497
AA Change: E335D

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098340
AA Change: E320D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497
AA Change: E320D

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196906
Predicted Effect probably damaging
Transcript: ENSMUST00000196981
AA Change: E344D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142851
Gene: ENSMUSG00000032497
AA Change: E344D

DomainStartEndE-ValueType
Pfam:DUF2051 31 350 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197241
AA Change: E335D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142816
Gene: ENSMUSG00000032497
AA Change: E335D

DomainStartEndE-ValueType
Pfam:DUF2051 31 341 1.3e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197256
AA Change: E357D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143322
Gene: ENSMUSG00000032497
AA Change: E357D

DomainStartEndE-ValueType
Pfam:DUF2051 31 363 2.9e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197540
Predicted Effect probably damaging
Transcript: ENSMUST00000216430
AA Change: E323D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217117
AA Change: E293D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217341
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Lrrfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lrrfip2 APN 9 111219715 missense probably damaging 1.00
IGL01408:Lrrfip2 APN 9 111214216 missense probably benign 0.11
IGL01462:Lrrfip2 APN 9 111205849 critical splice donor site probably null
IGL01845:Lrrfip2 APN 9 111199660 splice site probably benign
IGL02218:Lrrfip2 APN 9 111219725 missense probably benign
IGL02986:Lrrfip2 APN 9 111161393 splice site probably null
R0091:Lrrfip2 UTSW 9 111214243 missense probably damaging 1.00
R1101:Lrrfip2 UTSW 9 111190225 missense probably damaging 1.00
R1722:Lrrfip2 UTSW 9 111199761 missense probably damaging 1.00
R2334:Lrrfip2 UTSW 9 111219725 missense probably benign
R2336:Lrrfip2 UTSW 9 111222215 missense probably damaging 1.00
R4357:Lrrfip2 UTSW 9 111199687 missense probably damaging 1.00
R5010:Lrrfip2 UTSW 9 111223972 missense possibly damaging 0.79
R5072:Lrrfip2 UTSW 9 111199804 missense probably damaging 1.00
R6026:Lrrfip2 UTSW 9 111214171 missense probably damaging 1.00
R6307:Lrrfip2 UTSW 9 111223953 missense probably damaging 1.00
R6870:Lrrfip2 UTSW 9 111216119 intron probably benign
R7099:Lrrfip2 UTSW 9 111173108 missense probably benign 0.04
R7312:Lrrfip2 UTSW 9 111177457 splice site probably null
R7429:Lrrfip2 UTSW 9 111185126 splice site probably null
R7847:Lrrfip2 UTSW 9 111213880 missense probably damaging 1.00
R7866:Lrrfip2 UTSW 9 111193081 missense possibly damaging 0.95
R7912:Lrrfip2 UTSW 9 111205768 missense probably damaging 1.00
Z1176:Lrrfip2 UTSW 9 111161340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCACAAGTATAGGAGCTTC -3'
(R):5'- ATGCAAAGCTGGATTACCCC -3'

Sequencing Primer
(F):5'- GGAGCTTCTTGTAGTACATAGCATCC -3'
(R):5'- GGATTACCCCACCAGGTGTTC -3'
Posted On2015-02-05