Mutagenetix > Incidental Mutation

Incidental Mutation 'R3103:Oit3'

262912

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

040577-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R3103 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59438891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 29 (I29T)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

AlphaFold

Q8R4V5

Predicted Effect

probably damaging
Transcript: ENSMUST00000009798
AA Change: I29T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: I29T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	A	G	7: 28,610,984		probably null	Het
Adap2	G	T	11: 80,157,033	C105F	probably damaging	Het
Bace2	T	C	16: 97,422,001		probably null	Het
Bpifc	A	G	10: 85,993,422	S94P	probably damaging	Het
C2cd3	A	G	7: 100,395,252	D347G	possibly damaging	Het
Cad	T	C	5: 31,061,674	V613A	possibly damaging	Het
Ccdc47	T	C	11: 106,202,841	H6R	probably benign	Het
Celsr3	A	G	9: 108,837,139	T1956A	probably benign	Het
Cep128	T	A	12: 91,019,344	D1006V	probably damaging	Het
Cog3	T	C	14: 75,747,201		probably null	Het
Csmd1	C	T	8: 15,917,405	V3153M	probably damaging	Het
Ctnna2	T	C	6: 77,653,144	E122G	possibly damaging	Het
Cts8	T	A	13: 61,250,958	I245F	probably damaging	Het
Ddx27	T	A	2: 167,026,246	V333E	probably damaging	Het
Dmpk	A	G	7: 19,087,654	Y279C	probably damaging	Het
Dpagt1	A	G	9: 44,327,995	I111V	probably benign	Het
Dvl2	C	A	11: 70,008,869	P546T	possibly damaging	Het
Fat4	G	T	3: 38,891,940	A1661S	probably benign	Het
Gcm1	A	G	9: 78,064,452	N225S	probably damaging	Het
Gcnt2	A	T	13: 40,918,606	M242L	probably benign	Het
Golgb1	A	G	16: 36,894,849	R226G	probably damaging	Het
Gpr63	G	A	4: 25,007,353	V26I	probably benign	Het
Grik2	A	G	10: 49,240,772	L631P	probably damaging	Het
Hapln3	T	C	7: 79,121,736	D135G	probably benign	Het
Il31ra	C	A	13: 112,530,351	V398F	probably damaging	Het
Ipp	G	T	4: 116,524,249	R315L	possibly damaging	Het
Kcmf1	A	G	6: 72,861,847	L32P	probably damaging	Het
Klf17	T	A	4: 117,760,608	Q184L	possibly damaging	Het
Lrp2	C	T	2: 69,431,984	V4442I	probably benign	Het
Lrrfip2	A	T	9: 111,222,210	E293D	probably damaging	Het
Olfr403	G	A	11: 74,196,075	D191N	probably benign	Het
Olfr50	T	C	2: 36,793,562	C109R	possibly damaging	Het
Olfr555	T	C	7: 102,659,481	V220A	probably benign	Het
Plb1	T	A	5: 32,328,029	M842K	possibly damaging	Het
Ppt1	T	C	4: 122,836,307	C18R	probably benign	Het
Pstpip2	T	C	18: 77,871,777	Y191H	probably damaging	Het
Ryr1	C	T	7: 29,074,948	V2361I	probably damaging	Het
Serpinb11	A	G	1: 107,377,608	N238S	probably benign	Het
Skor2	A	T	18: 76,859,278	K232*	probably null	Het
Slc13a5	A	T	11: 72,257,388	W231R	probably damaging	Het
Svs5	A	T	2: 164,333,393	E55V	probably benign	Het
Tfcp2	A	T	15: 100,525,600	W142R	probably damaging	Het
Trpc2	A	T	7: 102,095,234	I738F	possibly damaging	Het
Vmn2r61	T	A	7: 42,266,643	S227T	possibly damaging	Het
Zfhx4	A	G	3: 5,399,326	T1540A	probably damaging	Het
Zfp616	A	G	11: 74,071,735	T74A	probably benign	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAGCCAGACAGGAGCATG -3'
(R):5'- CTGCCACTTTTGCAAAGGTAAC -3'

Sequencing Primer
(F):5'- GCATGGGTCCCACAGTGATTTTC -3'
(R):5'- ACCATAGGCTGATATTGATCCGG -3'

Posted On

2015-02-05