Incidental Mutation 'R3103:Oit3'
ID262912
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Nameoncoprotein induced transcript 3
SynonymsEF-9
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location59422958-59441778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59438891 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: I29T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: I29T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59425484 unclassified probably benign
IGL01665:Oit3 APN 10 59438909 missense probably damaging 1.00
IGL01839:Oit3 APN 10 59429496 missense probably damaging 0.98
IGL02028:Oit3 APN 10 59438655 missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59431013 missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59435978 missense probably damaging 0.99
R0781:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1110:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1563:Oit3 UTSW 10 59428074 missense probably damaging 1.00
R1623:Oit3 UTSW 10 59428239 missense probably damaging 0.99
R1693:Oit3 UTSW 10 59425417 missense probably damaging 1.00
R1754:Oit3 UTSW 10 59427940 splice site probably null
R1853:Oit3 UTSW 10 59441622 critical splice donor site probably null
R2070:Oit3 UTSW 10 59431013 missense probably benign 0.03
R2211:Oit3 UTSW 10 59428070 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59428345 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59441685 start gained probably benign
R4414:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4415:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4416:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4417:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4584:Oit3 UTSW 10 59425462 missense probably damaging 1.00
R4734:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4748:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4749:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R5070:Oit3 UTSW 10 59424027 missense probably damaging 1.00
R5521:Oit3 UTSW 10 59435914 missense probably benign
R6326:Oit3 UTSW 10 59428239 missense probably damaging 1.00
R6490:Oit3 UTSW 10 59438552 missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59429640 missense probably damaging 1.00
R6766:Oit3 UTSW 10 59438712 missense probably damaging 0.99
R6921:Oit3 UTSW 10 59435945 missense probably damaging 0.99
R7129:Oit3 UTSW 10 59428344 missense probably damaging 0.99
R7440:Oit3 UTSW 10 59429570 missense probably damaging 0.99
R7495:Oit3 UTSW 10 59423943 missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59438894 missense probably damaging 1.00
R7866:Oit3 UTSW 10 59424030 missense probably benign 0.03
R8312:Oit3 UTSW 10 59438810 missense probably benign 0.01
R8321:Oit3 UTSW 10 59428160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGCCAGACAGGAGCATG -3'
(R):5'- CTGCCACTTTTGCAAAGGTAAC -3'

Sequencing Primer
(F):5'- GCATGGGTCCCACAGTGATTTTC -3'
(R):5'- ACCATAGGCTGATATTGATCCGG -3'
Posted On2015-02-05