Incidental Mutation 'R3103:Bpifc'
ID262913
Institutional Source Beutler Lab
Gene Symbol Bpifc
Ensembl Gene ENSMUSG00000050108
Gene NameBPI fold containing family C
SynonymsBpil2
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85959340-86011895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85993422 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000063107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061699] [ENSMUST00000105304]
Predicted Effect probably damaging
Transcript: ENSMUST00000061699
AA Change: S94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108
AA Change: S94P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105304
SMART Domains Protein: ENSMUSP00000100941
Gene: ENSMUSG00000050108

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1ewfa1 26 82 2e-13 SMART
Blast:BPI1 33 82 7e-27 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Bpifc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Bpifc APN 10 85960528 missense possibly damaging 0.85
IGL01474:Bpifc APN 10 86000639 start codon destroyed probably damaging 0.98
IGL02437:Bpifc APN 10 85988731 missense probably damaging 1.00
R0689:Bpifc UTSW 10 85960547 splice site probably benign
R1205:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R1524:Bpifc UTSW 10 85977735 missense probably benign 0.01
R2033:Bpifc UTSW 10 86000632 missense possibly damaging 0.88
R3609:Bpifc UTSW 10 86000638 start codon destroyed probably null 1.00
R3874:Bpifc UTSW 10 85991254 missense probably benign
R4728:Bpifc UTSW 10 85991199 missense possibly damaging 0.50
R5079:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R5193:Bpifc UTSW 10 86000633 missense probably benign 0.01
R6280:Bpifc UTSW 10 85977712 missense probably benign 0.02
R6291:Bpifc UTSW 10 85976258 missense probably damaging 1.00
R6945:Bpifc UTSW 10 85979214 missense probably benign 0.00
R7288:Bpifc UTSW 10 85988721 missense possibly damaging 0.95
R7310:Bpifc UTSW 10 85963027 missense probably damaging 1.00
R7463:Bpifc UTSW 10 85979334 missense probably benign 0.00
R7807:Bpifc UTSW 10 85976250 missense possibly damaging 0.80
R8004:Bpifc UTSW 10 85979284 missense probably benign
Z1176:Bpifc UTSW 10 85965228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCTCGAGAAAGTATGGGTAC -3'
(R):5'- TTCTTGCTAAGAGGGCGCATG -3'

Sequencing Primer
(F):5'- TCTCGAGAAAGTATGGGTACAGAGAG -3'
(R):5'- CGCATGAGGATGTGGGC -3'
Posted On2015-02-05