Incidental Mutation 'R3103:Adap2'
ID 262917
Institutional Source Beutler Lab
Gene Symbol Adap2
Ensembl Gene ENSMUSG00000020709
Gene Name ArfGAP with dual PH domains 2
Synonyms centaurin alpha 2, Centa2
MMRRC Submission 040577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R3103 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 80154105-80178958 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80157033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 105 (C105F)
Ref Sequence ENSEMBL: ENSMUSP00000130731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021050] [ENSMUST00000134118]
AlphaFold Q8R2V5
Predicted Effect probably damaging
Transcript: ENSMUST00000021050
AA Change: C105F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021050
Gene: ENSMUSG00000020709
AA Change: C105F

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
PH 133 235 4.57e-8 SMART
PH 256 363 2.35e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134118
AA Change: C105F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130731
Gene: ENSMUSG00000020709
AA Change: C105F

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds beta-tubulin and increases the stability of microtubules. The encoded protein can also translocate to the cell membrane and bind phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4). In addition, this protein is a GTPase-activating protein for ADP ribosylation factor 6 and may be able to block the entry of some RNA viruses. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Adap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Adap2 APN 11 80160189 missense probably damaging 1.00
IGL02442:Adap2 APN 11 80177206 missense probably damaging 1.00
IGL02953:Adap2 APN 11 80154300 missense probably damaging 0.99
PIT4283001:Adap2 UTSW 11 80177263 missense probably damaging 1.00
R0157:Adap2 UTSW 11 80165701 missense probably damaging 1.00
R0382:Adap2 UTSW 11 80178385 splice site probably benign
R0499:Adap2 UTSW 11 80176079 missense probably damaging 1.00
R0722:Adap2 UTSW 11 80156984 missense possibly damaging 0.86
R0828:Adap2 UTSW 11 80165664 splice site probably benign
R1938:Adap2 UTSW 11 80170682 missense probably damaging 1.00
R2268:Adap2 UTSW 11 80165726 missense probably damaging 0.99
R4621:Adap2 UTSW 11 80174073 splice site probably null
R5157:Adap2 UTSW 11 80156946 missense probably damaging 1.00
R6326:Adap2 UTSW 11 80155022 missense probably damaging 1.00
R6914:Adap2 UTSW 11 80155065 missense probably benign 0.01
R6942:Adap2 UTSW 11 80155065 missense probably benign 0.01
R7835:Adap2 UTSW 11 80160231 missense probably benign 0.11
R8879:Adap2 UTSW 11 80156959 missense probably benign 0.02
R9183:Adap2 UTSW 11 80155056 missense probably damaging 0.99
R9408:Adap2 UTSW 11 80155116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTCTGGGTGAGCCATG -3'
(R):5'- CATGCTGACTTCCACCTAGC -3'

Sequencing Primer
(F):5'- GAGCCATGGTTTCATTTCAAGTTC -3'
(R):5'- GACTTCCACCTAGCTGTGTGG -3'
Posted On 2015-02-05