Incidental Mutation 'R3103:Cts8'
ID262919
Institutional Source Beutler Lab
Gene Symbol Cts8
Ensembl Gene ENSMUSG00000057446
Gene Namecathepsin 8
SynonymsCTS2, Epcs68, Epcs70
MMRRC Submission 040577-MU
Accession Numbers

Genbank: NM_019541; MGI: 1860275

Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location61246745-61255358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61250958 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 245 (I245F)
Ref Sequence ENSEMBL: ENSMUSP00000021891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021891] [ENSMUST00000223988]
Predicted Effect probably damaging
Transcript: ENSMUST00000021891
AA Change: I245F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021891
Gene: ENSMUSG00000057446
AA Change: I245F

DomainStartEndE-ValueType
Inhibitor_I29 29 88 1.92e-21 SMART
Pept_C1 114 332 2.28e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223988
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Cts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Cts8 APN 13 61251578 missense probably damaging 1.00
IGL01343:Cts8 APN 13 61249196 splice site probably benign
IGL01681:Cts8 APN 13 61253619 missense probably benign 0.01
IGL02264:Cts8 APN 13 61250958 missense probably damaging 1.00
IGL02686:Cts8 APN 13 61250970 missense probably benign 0.09
IGL03196:Cts8 APN 13 61253458 missense probably benign 0.05
R0123:Cts8 UTSW 13 61253577 missense probably benign 0.01
R0630:Cts8 UTSW 13 61253442 missense possibly damaging 0.71
R0856:Cts8 UTSW 13 61250916 missense probably damaging 1.00
R0908:Cts8 UTSW 13 61250916 missense probably damaging 1.00
R1932:Cts8 UTSW 13 61253615 missense probably damaging 0.98
R2186:Cts8 UTSW 13 61251731 missense probably damaging 1.00
R3772:Cts8 UTSW 13 61250901 splice site probably benign
R5127:Cts8 UTSW 13 61253335 missense probably damaging 1.00
R5432:Cts8 UTSW 13 61251012 missense probably benign 0.00
R6088:Cts8 UTSW 13 61253966 missense probably benign 0.01
R6298:Cts8 UTSW 13 61249223 missense possibly damaging 0.77
R6501:Cts8 UTSW 13 61250942 missense probably damaging 1.00
R7177:Cts8 UTSW 13 61251691 missense possibly damaging 0.48
R7571:Cts8 UTSW 13 61248167 missense probably damaging 1.00
RF008:Cts8 UTSW 13 61249288 missense probably benign
X0062:Cts8 UTSW 13 61251008 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTAGCAGGGGTCTCAAAATCATTC -3'
(R):5'- TGCCTCTTTGCAGGTGAATG -3'

Sequencing Primer
(F):5'- GTTTCGATGACCCCCAACC -3'
(R):5'- CCTCTTTGCAGGTGAATGGAAATAAC -3'
Posted On2015-02-05