Incidental Mutation 'R3103:Bace2'
ID 262927
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 040577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R3103 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 97223201 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275] [ENSMUST00000231664]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047275
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231783
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,310,409 (GRCm39) probably null Het
Adap2 G T 11: 80,047,859 (GRCm39) C105F probably damaging Het
Bpifc A G 10: 85,829,286 (GRCm39) S94P probably damaging Het
C2cd3 A G 7: 100,044,459 (GRCm39) D347G possibly damaging Het
Cad T C 5: 31,219,018 (GRCm39) V613A possibly damaging Het
Ccdc47 T C 11: 106,093,667 (GRCm39) H6R probably benign Het
Celsr3 A G 9: 108,714,338 (GRCm39) T1956A probably benign Het
Cep128 T A 12: 90,986,118 (GRCm39) D1006V probably damaging Het
Cog3 T C 14: 75,984,641 (GRCm39) probably null Het
Csmd1 C T 8: 15,967,405 (GRCm39) V3153M probably damaging Het
Ctnna2 T C 6: 77,630,127 (GRCm39) E122G possibly damaging Het
Cts8 T A 13: 61,398,772 (GRCm39) I245F probably damaging Het
Ddx27 T A 2: 166,868,166 (GRCm39) V333E probably damaging Het
Dmpk A G 7: 18,821,579 (GRCm39) Y279C probably damaging Het
Dpagt1 A G 9: 44,239,292 (GRCm39) I111V probably benign Het
Dvl2 C A 11: 69,899,695 (GRCm39) P546T possibly damaging Het
Fat4 G T 3: 38,946,089 (GRCm39) A1661S probably benign Het
Gcm1 A G 9: 77,971,734 (GRCm39) N225S probably damaging Het
Gcnt2 A T 13: 41,072,082 (GRCm39) M242L probably benign Het
Golgb1 A G 16: 36,715,211 (GRCm39) R226G probably damaging Het
Gpr63 G A 4: 25,007,353 (GRCm39) V26I probably benign Het
Grik2 A G 10: 49,116,868 (GRCm39) L631P probably damaging Het
Hapln3 T C 7: 78,771,484 (GRCm39) D135G probably benign Het
Il31ra C A 13: 112,666,885 (GRCm39) V398F probably damaging Het
Ipp G T 4: 116,381,446 (GRCm39) R315L possibly damaging Het
Kcmf1 A G 6: 72,838,830 (GRCm39) L32P probably damaging Het
Klf17 T A 4: 117,617,805 (GRCm39) Q184L possibly damaging Het
Lrp2 C T 2: 69,262,328 (GRCm39) V4442I probably benign Het
Lrrfip2 A T 9: 111,051,278 (GRCm39) E293D probably damaging Het
Oit3 A G 10: 59,274,713 (GRCm39) I29T probably damaging Het
Or1a1 G A 11: 74,086,901 (GRCm39) D191N probably benign Het
Or1j21 T C 2: 36,683,574 (GRCm39) C109R possibly damaging Het
Or51h1 T C 7: 102,308,688 (GRCm39) V220A probably benign Het
Plb1 T A 5: 32,485,373 (GRCm39) M842K possibly damaging Het
Ppt1 T C 4: 122,730,100 (GRCm39) C18R probably benign Het
Pstpip2 T C 18: 77,959,477 (GRCm39) Y191H probably damaging Het
Ryr1 C T 7: 28,774,373 (GRCm39) V2361I probably damaging Het
Serpinb11 A G 1: 107,305,338 (GRCm39) N238S probably benign Het
Skor2 A T 18: 76,946,973 (GRCm39) K232* probably null Het
Slc13a5 A T 11: 72,148,214 (GRCm39) W231R probably damaging Het
Svs5 A T 2: 164,175,313 (GRCm39) E55V probably benign Het
Tfcp2 A T 15: 100,423,481 (GRCm39) W142R probably damaging Het
Trpc2 A T 7: 101,744,441 (GRCm39) I738F possibly damaging Het
Vmn2r61 T A 7: 41,916,067 (GRCm39) S227T possibly damaging Het
Zfhx4 A G 3: 5,464,386 (GRCm39) T1540A probably damaging Het
Zfp616 A G 11: 73,962,561 (GRCm39) T74A probably benign Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTTATGTGCCAGGCTG -3'
(R):5'- CGACATATGAGGTGAGACCATAAC -3'

Sequencing Primer
(F):5'- TGGTGCCTGCTTCTCACAGG -3'
(R):5'- CATCCCAGGCTTAAGTTAAGACATG -3'
Posted On 2015-02-05