Mutagenetix > Incidental Mutation

Incidental Mutation 'R3103:Bace2'

262927

Institutional Source

Beutler Lab

Gene Symbol

Bace2

Ensembl Gene

ENSMUSG00000040605

Gene Name

beta-site APP-cleaving enzyme 2

Synonyms

1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1

MMRRC Submission

040577-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R3103 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97356742-97442936 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 97422001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000043918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047275] [ENSMUST00000231664]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000047275

SMART Domains

Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Asp	87	427	2.3e-47	PFAM
Pfam:TAXi_C	269	426	4.4e-16	PFAM
transmembrane domain	466	488	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231783

Predicted Effect

probably benign
Transcript: ENSMUST00000231892

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	A	G	7: 28,610,984		probably null	Het
Adap2	G	T	11: 80,157,033	C105F	probably damaging	Het
Bpifc	A	G	10: 85,993,422	S94P	probably damaging	Het
C2cd3	A	G	7: 100,395,252	D347G	possibly damaging	Het
Cad	T	C	5: 31,061,674	V613A	possibly damaging	Het
Ccdc47	T	C	11: 106,202,841	H6R	probably benign	Het
Celsr3	A	G	9: 108,837,139	T1956A	probably benign	Het
Cep128	T	A	12: 91,019,344	D1006V	probably damaging	Het
Cog3	T	C	14: 75,747,201		probably null	Het
Csmd1	C	T	8: 15,917,405	V3153M	probably damaging	Het
Ctnna2	T	C	6: 77,653,144	E122G	possibly damaging	Het
Cts8	T	A	13: 61,250,958	I245F	probably damaging	Het
Ddx27	T	A	2: 167,026,246	V333E	probably damaging	Het
Dmpk	A	G	7: 19,087,654	Y279C	probably damaging	Het
Dpagt1	A	G	9: 44,327,995	I111V	probably benign	Het
Dvl2	C	A	11: 70,008,869	P546T	possibly damaging	Het
Fat4	G	T	3: 38,891,940	A1661S	probably benign	Het
Gcm1	A	G	9: 78,064,452	N225S	probably damaging	Het
Gcnt2	A	T	13: 40,918,606	M242L	probably benign	Het
Golgb1	A	G	16: 36,894,849	R226G	probably damaging	Het
Gpr63	G	A	4: 25,007,353	V26I	probably benign	Het
Grik2	A	G	10: 49,240,772	L631P	probably damaging	Het
Hapln3	T	C	7: 79,121,736	D135G	probably benign	Het
Il31ra	C	A	13: 112,530,351	V398F	probably damaging	Het
Ipp	G	T	4: 116,524,249	R315L	possibly damaging	Het
Kcmf1	A	G	6: 72,861,847	L32P	probably damaging	Het
Klf17	T	A	4: 117,760,608	Q184L	possibly damaging	Het
Lrp2	C	T	2: 69,431,984	V4442I	probably benign	Het
Lrrfip2	A	T	9: 111,222,210	E293D	probably damaging	Het
Oit3	A	G	10: 59,438,891	I29T	probably damaging	Het
Olfr403	G	A	11: 74,196,075	D191N	probably benign	Het
Olfr50	T	C	2: 36,793,562	C109R	possibly damaging	Het
Olfr555	T	C	7: 102,659,481	V220A	probably benign	Het
Plb1	T	A	5: 32,328,029	M842K	possibly damaging	Het
Ppt1	T	C	4: 122,836,307	C18R	probably benign	Het
Pstpip2	T	C	18: 77,871,777	Y191H	probably damaging	Het
Ryr1	C	T	7: 29,074,948	V2361I	probably damaging	Het
Serpinb11	A	G	1: 107,377,608	N238S	probably benign	Het
Skor2	A	T	18: 76,859,278	K232*	probably null	Het
Slc13a5	A	T	11: 72,257,388	W231R	probably damaging	Het
Svs5	A	T	2: 164,333,393	E55V	probably benign	Het
Tfcp2	A	T	15: 100,525,600	W142R	probably damaging	Het
Trpc2	A	T	7: 102,095,234	I738F	possibly damaging	Het
Vmn2r61	T	A	7: 42,266,643	S227T	possibly damaging	Het
Zfhx4	A	G	3: 5,399,326	T1540A	probably damaging	Het
Zfp616	A	G	11: 74,071,735	T74A	probably benign	Het

Other mutations in Bace2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01129:Bace2	APN	16	97408430	missense	probably damaging	0.97
IGL02660:Bace2	APN	16	97415140	missense	probably damaging	1.00
IGL02669:Bace2	APN	16	97436893	makesense	probably null
R0244:Bace2	UTSW	16	97436773	splice site	probably null
R0674:Bace2	UTSW	16	97436749	missense	possibly damaging	0.93
R0906:Bace2	UTSW	16	97356941	missense	possibly damaging	0.67
R1078:Bace2	UTSW	16	97356860	missense	unknown
R1670:Bace2	UTSW	16	97412135	missense	probably damaging	0.96
R1997:Bace2	UTSW	16	97415089	missense	possibly damaging	0.93
R2050:Bace2	UTSW	16	97412136	missense	probably damaging	1.00
R2937:Bace2	UTSW	16	97412188	critical splice donor site	probably null
R2938:Bace2	UTSW	16	97412188	critical splice donor site	probably null
R3755:Bace2	UTSW	16	97436657	missense	probably benign	0.34
R4110:Bace2	UTSW	16	97436656	missense	probably benign
R4112:Bace2	UTSW	16	97436656	missense	probably benign
R4113:Bace2	UTSW	16	97436656	missense	probably benign
R4560:Bace2	UTSW	16	97421980	missense	probably damaging	1.00
R4562:Bace2	UTSW	16	97421980	missense	probably damaging	1.00
R4563:Bace2	UTSW	16	97421980	missense	probably damaging	1.00
R4717:Bace2	UTSW	16	97436873	missense	probably damaging	1.00
R5535:Bace2	UTSW	16	97413425	missense	probably damaging	1.00
R6282:Bace2	UTSW	16	97415097	missense	probably damaging	1.00
R6364:Bace2	UTSW	16	97413433	missense	probably benign	0.05
R7045:Bace2	UTSW	16	97399665	missense	probably damaging	1.00
R7241:Bace2	UTSW	16	97436798	missense	possibly damaging	0.92
R7546:Bace2	UTSW	16	97399682	missense	probably benign	0.01
R7653:Bace2	UTSW	16	97436652	missense
R8026:Bace2	UTSW	16	97436852	missense	probably benign	0.26
R8171:Bace2	UTSW	16	97424586	missense	possibly damaging	0.86
R8324:Bace2	UTSW	16	97356908	missense	possibly damaging	0.51
R8341:Bace2	UTSW	16	97356908	missense	possibly damaging	0.51
R8480:Bace2	UTSW	16	97413470	missense	probably damaging	1.00
R9205:Bace2	UTSW	16	97356859	missense	unknown
R9221:Bace2	UTSW	16	97408492	missense	probably benign	0.01
X0024:Bace2	UTSW	16	97413398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGTTATGTGCCAGGCTG -3'
(R):5'- CGACATATGAGGTGAGACCATAAC -3'

Sequencing Primer
(F):5'- TGGTGCCTGCTTCTCACAGG -3'
(R):5'- CATCCCAGGCTTAAGTTAAGACATG -3'

Posted On

2015-02-05