Mutagenetix > Incidental Mutation

Incidental Mutation 'R3104:Cntln'

262945

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

040578-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R3104 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84957169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 280 (T280M)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047023
AA Change: T280M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T280M

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102819
AA Change: T280M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: T280M

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
coiled coil region	166	277	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169371
AA Change: T280M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T280M

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.4%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ash1l	T	A	3: 89,054,386	V2355E	probably damaging	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Bmp4	G	A	14: 46,385,981	A36V	probably benign	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Cdh9	T	C	15: 16,855,814	S647P	probably damaging	Het
Coch	A	G	12: 51,603,421	T398A	probably benign	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Csmd1	A	G	8: 17,027,231	Y137H	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Cyp19a1	T	C	9: 54,186,799	I60V	probably benign	Het
Cyp2c68	C	T	19: 39,734,313	V264I	probably benign	Het
Dbx1	A	T	7: 49,636,669	L16H	probably damaging	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dnah7c	T	A	1: 46,798,279	Y3951N	probably damaging	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Fam124b	T	A	1: 80,213,031	I212F	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gfpt1	A	G	6: 87,057,646	D142G	probably benign	Het
Gm5174	A	G	10: 86,656,655		noncoding transcript	Het
Gtf2ird2	G	A	5: 134,208,915	D278N	probably benign	Het
Herc2	T	A	7: 56,135,355	D1480E	probably benign	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Itpr2	A	T	6: 146,312,837		probably null	Het
Lgr6	A	G	1: 135,000,472		probably null	Het
Lmod2	A	C	6: 24,604,472	K482T	probably damaging	Het
Magi3	A	G	3: 104,051,320	V483A	probably damaging	Het
Ncam2	A	G	16: 81,465,710		probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1094	T	C	2: 86,829,691	M313T	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pcdhgc5	A	G	18: 37,821,674	E667G	possibly damaging	Het
Plce1	C	T	19: 38,620,519	P424L	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Prkag2	T	A	5: 24,871,069	K233*	probably null	Het
Prune2	T	A	19: 17,119,156	S675T	probably damaging	Het
Sars	C	T	3: 108,429,305	R302H	probably damaging	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Unc80	G	A	1: 66,623,291	V1768I	probably benign	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Usp29	T	A	7: 6,962,053	C298*	probably null	Het
Usp8	T	C	2: 126,758,512	V1050A	probably damaging	Het
Vmn1r38	T	C	6: 66,776,446	T229A	probably benign	Het
Yes1	T	C	5: 32,653,171	S195P	probably damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAATATGGAGAAGCTGCTGCGC -3'
(R):5'- AGTCAGTTTCCTGCTTTGCAAC -3'

Sequencing Primer
(F):5'- GCCCTTGTGGTACTGTTCTACAG -3'
(R):5'- CCTACTGGTGGATCTGAA -3'

Posted On

2015-02-05