Incidental Mutation 'R3104:Yes1'
ID262949
Institutional Source Beutler Lab
Gene Symbol Yes1
Ensembl Gene ENSMUSG00000014932
Gene NameYES proto-oncogene 1, Src family tyrosine kinase
SynonymsYes
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32611171-32687057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32653171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000144001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]
Predicted Effect probably damaging
Transcript: ENSMUST00000072311
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155976
Predicted Effect probably damaging
Transcript: ENSMUST00000168707
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200999
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 3.1e-24 SMART
SH2 154 198 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202543
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Meta Mutation Damage Score 0.8431 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Other mutations in Yes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Yes1 APN 5 32655129 missense probably benign 0.00
IGL02816:Yes1 APN 5 32645107 missense probably damaging 1.00
IGL02974:Yes1 APN 5 32660768 missense probably damaging 0.97
PIT4696001:Yes1 UTSW 5 32684625 missense possibly damaging 0.70
R0139:Yes1 UTSW 5 32684695 missense possibly damaging 0.87
R0481:Yes1 UTSW 5 32640405 nonsense probably null
R0486:Yes1 UTSW 5 32655582 nonsense probably null
R0526:Yes1 UTSW 5 32655240 missense probably benign 0.15
R0648:Yes1 UTSW 5 32655518 missense possibly damaging 0.90
R1083:Yes1 UTSW 5 32651757 critical splice donor site probably null
R1463:Yes1 UTSW 5 32651702 missense probably benign 0.04
R1569:Yes1 UTSW 5 32653163 missense probably damaging 1.00
R1899:Yes1 UTSW 5 32645051 missense probably damaging 1.00
R1918:Yes1 UTSW 5 32684735 missense probably benign 0.00
R2183:Yes1 UTSW 5 32645026 missense probably damaging 1.00
R2913:Yes1 UTSW 5 32640582 missense probably benign
R2914:Yes1 UTSW 5 32640582 missense probably benign
R4407:Yes1 UTSW 5 32640585 missense possibly damaging 0.51
R4736:Yes1 UTSW 5 32660777 missense probably damaging 0.98
R4939:Yes1 UTSW 5 32645113 splice site probably null
R6187:Yes1 UTSW 5 32645041 missense probably damaging 1.00
R6318:Yes1 UTSW 5 32651686 missense possibly damaging 0.92
R6467:Yes1 UTSW 5 32653037 missense probably damaging 0.98
R7578:Yes1 UTSW 5 32645086 missense probably benign 0.27
R7756:Yes1 UTSW 5 32684680 missense probably damaging 1.00
X0062:Yes1 UTSW 5 32653043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGAAAGATTACTTCTGAATCC -3'
(R):5'- GCAACATGCAAGTCTTGTTCC -3'

Sequencing Primer
(F):5'- CTGAATCCTGGGAATCAGCG -3'
(R):5'- GTTTCATCCATAGGAGCCACATAGTG -3'
Posted On2015-02-05