Incidental Mutation 'R3104:Vmn1r38'
ID262954
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66776446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect probably benign
Transcript: ENSMUST00000176121
AA Change: T229A

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: T229A

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226457
AA Change: T229A

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227493
AA Change: T229A

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227694
AA Change: T229A

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R0890:Vmn1r38 UTSW 6 66776530 missense probably benign 0.01
R1242:Vmn1r38 UTSW 6 66776360 nonsense probably null
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2320:Vmn1r38 UTSW 6 66776550 missense possibly damaging 0.94
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R4532:Vmn1r38 UTSW 6 66777032 missense probably benign 0.38
R5299:Vmn1r38 UTSW 6 66776698 missense probably benign 0.06
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
R8044:Vmn1r38 UTSW 6 66776532 missense not run
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATACCAGGAATGCACACATG -3'
(R):5'- CAACATCATCAGGGGACTAATTTC -3'

Sequencing Primer
(F):5'- TGCCAGGCCAAAACTAATACATATG -3'
(R):5'- CATCAGGGGACTAATTTCAACAATC -3'
Posted On2015-02-05