Incidental Mutation 'R3104:Sppl2b'
ID 262965
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 040578-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R3104 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80703325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 529 (E529G)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091] [ENSMUST00000219817]
AlphaFold Q3TD49
Predicted Effect probably benign
Transcript: ENSMUST00000035597
AA Change: E529G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: E529G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217714
Predicted Effect probably benign
Transcript: ENSMUST00000218789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219366
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219951
Meta Mutation Damage Score 0.1628 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 88,961,693 (GRCm39) V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Bmp4 G A 14: 46,623,438 (GRCm39) A36V probably benign Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Cdh9 T C 15: 16,855,900 (GRCm39) S647P probably damaging Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Coch A G 12: 51,650,204 (GRCm39) T398A probably benign Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Csmd1 A G 8: 17,077,247 (GRCm39) Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Cyp19a1 T C 9: 54,094,083 (GRCm39) I60V probably benign Het
Cyp2c68 C T 19: 39,722,757 (GRCm39) V264I probably benign Het
Dbx1 A T 7: 49,286,417 (GRCm39) L16H probably damaging Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dnah7c T A 1: 46,837,439 (GRCm39) Y3951N probably damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Fam124b T A 1: 80,190,748 (GRCm39) I212F probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Gfpt1 A G 6: 87,034,628 (GRCm39) D142G probably benign Het
Gm5174 A G 10: 86,492,519 (GRCm39) noncoding transcript Het
Gtf2ird2 G A 5: 134,237,756 (GRCm39) D278N probably benign Het
Herc2 T A 7: 55,785,103 (GRCm39) D1480E probably benign Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Itpr2 A T 6: 146,214,335 (GRCm39) probably null Het
Lgr6 A G 1: 134,928,210 (GRCm39) probably null Het
Lmod2 A C 6: 24,604,471 (GRCm39) K482T probably damaging Het
Magi3 A G 3: 103,958,636 (GRCm39) V483A probably damaging Het
Ncam2 A G 16: 81,262,598 (GRCm39) probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or5t9 T C 2: 86,660,035 (GRCm39) M313T probably benign Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pcdhgc5 A G 18: 37,954,727 (GRCm39) E667G possibly damaging Het
Plce1 C T 19: 38,608,963 (GRCm39) P424L probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Prkag2 T A 5: 25,076,067 (GRCm39) K233* probably null Het
Prune2 T A 19: 17,096,520 (GRCm39) S675T probably damaging Het
Sars1 C T 3: 108,336,621 (GRCm39) R302H probably damaging Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Unc80 G A 1: 66,662,450 (GRCm39) V1768I probably benign Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Usp29 T A 7: 6,965,052 (GRCm39) C298* probably null Het
Usp8 T C 2: 126,600,432 (GRCm39) V1050A probably damaging Het
Vmn1r38 T C 6: 66,753,430 (GRCm39) T229A probably benign Het
Yes1 T C 5: 32,810,515 (GRCm39) S195P probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AATGCCTCCTGCTCTAAGTGTC -3'
(R):5'- AGGCCTGAGCACCATGTTAG -3'

Sequencing Primer
(F):5'- CCTGCACCTGTGTGGGTTC -3'
(R):5'- CCAGGTGGTCAGCATCTGTG -3'
Posted On 2015-02-05