Incidental Mutation 'R3104:Tkfc'
ID262982
Institutional Source Beutler Lab
Gene Symbol Tkfc
Ensembl Gene ENSMUSG00000034371
Gene Nametriokinase, FMN cyclase
SynonymsDak
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10592200-10604258 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 10596993 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 198 (C198*)
Ref Sequence ENSEMBL: ENSMUSP00000044556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678]
Predicted Effect probably null
Transcript: ENSMUST00000037678
AA Change: C198*
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: C198*

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Tkfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tkfc APN 19 10594528 missense probably benign 0.28
IGL01149:Tkfc APN 19 10600651 missense probably damaging 1.00
IGL02726:Tkfc APN 19 10596212 missense possibly damaging 0.67
IGL03069:Tkfc APN 19 10599154 missense probably benign
R1367:Tkfc UTSW 19 10593474 missense probably benign 0.19
R1476:Tkfc UTSW 19 10595326 missense probably null 0.55
R2081:Tkfc UTSW 19 10597378 missense probably damaging 1.00
R2130:Tkfc UTSW 19 10596041 missense probably damaging 0.97
R2151:Tkfc UTSW 19 10599057 missense probably damaging 1.00
R2443:Tkfc UTSW 19 10594538 missense probably damaging 0.97
R3105:Tkfc UTSW 19 10596993 nonsense probably null
R3106:Tkfc UTSW 19 10596993 nonsense probably null
R5027:Tkfc UTSW 19 10592659 unclassified probably null
R5601:Tkfc UTSW 19 10594563 missense probably benign
R5637:Tkfc UTSW 19 10594533 missense probably benign 0.00
R5933:Tkfc UTSW 19 10597347 missense probably benign 0.17
R6792:Tkfc UTSW 19 10594524 missense probably benign
R6845:Tkfc UTSW 19 10599332 missense probably damaging 0.99
R6909:Tkfc UTSW 19 10596266 missense probably benign 0.06
R7007:Tkfc UTSW 19 10596363 missense probably benign
R7883:Tkfc UTSW 19 10595030 intron probably null
Predicted Primers PCR Primer
(F):5'- CTATGAGTCTAGAGACCACCTGAG -3'
(R):5'- TTATTCCCTGGAGCTAGCGG -3'

Sequencing Primer
(F):5'- CCACCTGAGGGGCATTAAATAAGC -3'
(R):5'- AAGGTCCTCTGGAGAGAGCCTG -3'
Posted On2015-02-05