Incidental Mutation 'R3105:Sars'
ID263000
Institutional Source Beutler Lab
Gene Symbol Sars
Ensembl Gene ENSMUSG00000068739
Gene Nameseryl-aminoacyl-tRNA synthetase
SynonymsStrs
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108424865-108445209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108429305 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 302 (R302H)
Ref Sequence ENSEMBL: ENSMUSP00000099685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090553] [ENSMUST00000102625] [ENSMUST00000132467] [ENSMUST00000153499]
Predicted Effect probably damaging
Transcript: ENSMUST00000090553
AA Change: R302H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088041
Gene: ENSMUSG00000068739
AA Change: R302H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-20 PFAM
Pfam:tRNA-synt_2b 203 386 4.1e-39 PFAM
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102625
AA Change: R302H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099685
Gene: ENSMUSG00000068739
AA Change: R302H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.3e-22 PFAM
Pfam:tRNA-synt_2b 248 427 2.1e-41 PFAM
low complexity region 505 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132467
AA Change: R254H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120879
Gene: ENSMUSG00000068739
AA Change: R254H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 6.1e-23 PFAM
Pfam:tRNA-synt_2b 155 338 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153499
SMART Domains Protein: ENSMUSP00000118676
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-23 PFAM
PDB:3VBB|F 150 187 3e-18 PDB
Meta Mutation Damage Score 0.9096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Sars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Sars APN 3 108426858 missense probably damaging 0.99
IGL02898:Sars APN 3 108429263 missense probably damaging 1.00
R0660:Sars UTSW 3 108431473 missense probably damaging 1.00
R0749:Sars UTSW 3 108428266 missense possibly damaging 0.95
R0855:Sars UTSW 3 108426932 missense probably benign 0.07
R1249:Sars UTSW 3 108435935 missense probably benign 0.14
R1540:Sars UTSW 3 108433145 missense probably benign 0.01
R1659:Sars UTSW 3 108429416 missense probably damaging 1.00
R1836:Sars UTSW 3 108435944 missense probably benign 0.00
R2120:Sars UTSW 3 108434156 missense probably benign 0.00
R3104:Sars UTSW 3 108429305 missense probably damaging 1.00
R6282:Sars UTSW 3 108428274 nonsense probably null
R7224:Sars UTSW 3 108428203 missense probably damaging 1.00
R7706:Sars UTSW 3 108431464 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGCGTTCTCTAGGCTC -3'
(R):5'- TCGGATGCAGTCTTTCCTCG -3'

Sequencing Primer
(F):5'- TAGGCTCTTCCCCACCAAG -3'
(R):5'- GCATGTATCCCTCCTCCAGGTG -3'
Posted On2015-02-05