Incidental Mutation 'R3105:Gm8730'
ID263010
Institutional Source Beutler Lab
Gene Symbol Gm8730
Ensembl Gene ENSMUSG00000063696
Gene Namepredicted pseudogene 8730
Synonyms
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location102864779-102865853 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 102865263 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000076373
SMART Domains Protein: ENSMUSP00000132472
Gene: ENSMUSG00000063696

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 5 106 3.1e-25 PFAM
low complexity region 109 117 N/A INTRINSIC
Pfam:Ribosomal_60s 231 316 3.7e-24 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Gm8730
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Gm8730 APN 8 102865143 exon noncoding transcript
R3725:Gm8730 UTSW 8 102865032 exon noncoding transcript
R3726:Gm8730 UTSW 8 102865032 exon noncoding transcript
R4689:Gm8730 UTSW 8 102865747 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGATGATGGAGTGTGGCACC -3'
(R):5'- AATAAGGTGCCAGCTGCTGC -3'

Sequencing Primer
(F):5'- CGAGGCAACAGTCGGGTAC -3'
(R):5'- TGTGAGGTCACTGTGCCAGC -3'
Posted On2015-02-05