Incidental Mutation 'R3105:Slc22a29'
ID263026
Institutional Source Beutler Lab
Gene Symbol Slc22a29
Ensembl Gene ENSMUSG00000075044
Gene Namesolute carrier family 22. member 29
SynonymsD630002G06Rik
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8160165-8218900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8169973 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 342 (T342A)
Ref Sequence ENSEMBL: ENSMUSP00000152815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113298] [ENSMUST00000222533]
Predicted Effect probably benign
Transcript: ENSMUST00000113298
AA Change: T342A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108923
Gene: ENSMUSG00000075044
AA Change: T342A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.3e-25 PFAM
Pfam:MFS_1 140 372 7.7e-14 PFAM
Pfam:MFS_1 348 549 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140910
SMART Domains Protein: ENSMUSP00000117625
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 98 454 4.6e-20 PFAM
Pfam:MFS_1 137 462 3.6e-15 PFAM
low complexity region 467 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149182
SMART Domains Protein: ENSMUSP00000122262
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
Pfam:Sugar_tr 62 418 2.2e-20 PFAM
Pfam:MFS_1 101 427 1.9e-15 PFAM
low complexity region 431 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222533
AA Change: T342A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Slc22a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc22a29 APN 19 8217813 missense probably benign 0.44
IGL00562:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00563:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00952:Slc22a29 APN 19 8217857 missense probably damaging 1.00
IGL01526:Slc22a29 APN 19 8207178 splice site probably benign
IGL01792:Slc22a29 APN 19 8218529 missense probably damaging 1.00
IGL02191:Slc22a29 APN 19 8218681 unclassified probably benign
IGL02391:Slc22a29 APN 19 8169353 missense probably benign 0.13
IGL02408:Slc22a29 APN 19 8207285 missense probably benign 0.00
IGL02957:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03059:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03299:Slc22a29 APN 19 8162648 critical splice donor site probably null
IGL03368:Slc22a29 APN 19 8207262 critical splice donor site probably null
R0017:Slc22a29 UTSW 19 8218266 splice site probably benign
R0105:Slc22a29 UTSW 19 8160627 unclassified probably benign
R0157:Slc22a29 UTSW 19 8162742 missense possibly damaging 0.61
R0265:Slc22a29 UTSW 19 8169970 missense probably benign 0.18
R1758:Slc22a29 UTSW 19 8217762 critical splice donor site probably null
R1918:Slc22a29 UTSW 19 8217759 splice site probably null
R1927:Slc22a29 UTSW 19 8207066 missense probably benign 0.01
R1959:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1960:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1961:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1966:Slc22a29 UTSW 19 8218408 missense probably damaging 1.00
R1968:Slc22a29 UTSW 19 8218343 missense probably benign 0.27
R1997:Slc22a29 UTSW 19 8217798 missense probably benign 0.00
R3725:Slc22a29 UTSW 19 8218609 missense possibly damaging 0.78
R4118:Slc22a29 UTSW 19 8160529 unclassified probably benign
R4465:Slc22a29 UTSW 19 8162724 nonsense probably null
R4584:Slc22a29 UTSW 19 8169291 missense probably benign 0.02
R4656:Slc22a29 UTSW 19 8218300 missense possibly damaging 0.90
R4679:Slc22a29 UTSW 19 8161584 missense possibly damaging 0.65
R4899:Slc22a29 UTSW 19 8161569 missense probably benign 0.00
R4913:Slc22a29 UTSW 19 8218358 missense probably benign 0.17
R5119:Slc22a29 UTSW 19 8217830 missense probably damaging 0.99
R5470:Slc22a29 UTSW 19 8161516 missense probably benign 0.01
R5474:Slc22a29 UTSW 19 8217857 missense probably damaging 1.00
R6794:Slc22a29 UTSW 19 8161523 missense probably benign 0.06
R6798:Slc22a29 UTSW 19 8160604 missense probably benign 0.16
R7025:Slc22a29 UTSW 19 8160580 missense probably benign
R7240:Slc22a29 UTSW 19 8161511 missense probably damaging 0.98
R7535:Slc22a29 UTSW 19 8169978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCACTGCACAGTAAGTTCC -3'
(R):5'- ACTGTAGAAATCCCCTGAGTGTC -3'

Sequencing Primer
(F):5'- TCACTGCACAGTAAGTTCCATATAC -3'
(R):5'- AGAAATCCCCTGAGTGTCTTTTTG -3'
Posted On2015-02-05