Incidental Mutation 'R3105:Taf6l'
ID263027
Institutional Source Beutler Lab
Gene Symbol Taf6l
Ensembl Gene ENSMUSG00000003680
Gene NameTATA-box binding protein associated factor 6 like
SynonymsPAF65A, 2810417N14Rik, C530024J06Rik
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8772522-8786417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8778855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 208 (S208N)
Ref Sequence ENSEMBL: ENSMUSP00000135220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]
Predicted Effect probably damaging
Transcript: ENSMUST00000003777
AA Change: S207N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: S207N

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010249
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176331
Predicted Effect probably benign
Transcript: ENSMUST00000176496
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176610
AA Change: S208N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: S208N

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176991
Predicted Effect probably benign
Transcript: ENSMUST00000177056
AA Change: S201N

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: S201N

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177216
AA Change: S208N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: S208N

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189739
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Taf6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Taf6l APN 19 8783388 missense probably benign 0.04
IGL00781:Taf6l APN 19 8773661 missense probably damaging 1.00
IGL01886:Taf6l APN 19 8778086 critical splice donor site probably null
IGL02638:Taf6l APN 19 8775266 missense probably benign 0.03
IGL02676:Taf6l APN 19 8775049 missense probably damaging 1.00
R0096:Taf6l UTSW 19 8778517 missense probably benign 0.06
R0110:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0469:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0510:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0676:Taf6l UTSW 19 8773369 missense probably benign 0.00
R0711:Taf6l UTSW 19 8778517 missense probably benign 0.06
R1804:Taf6l UTSW 19 8773634 missense probably damaging 0.99
R1971:Taf6l UTSW 19 8775502 unclassified probably null
R2869:Taf6l UTSW 19 8778628 unclassified probably benign
R2870:Taf6l UTSW 19 8778628 unclassified probably benign
R4578:Taf6l UTSW 19 8783971 missense possibly damaging 0.95
R4581:Taf6l UTSW 19 8778208 missense probably damaging 0.99
R4841:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R4842:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R5215:Taf6l UTSW 19 8778053 intron probably benign
R5269:Taf6l UTSW 19 8774962 missense probably damaging 1.00
R5571:Taf6l UTSW 19 8783930 missense probably damaging 1.00
R5687:Taf6l UTSW 19 8773312 missense probably benign 0.01
R5799:Taf6l UTSW 19 8782631 missense possibly damaging 0.93
R5814:Taf6l UTSW 19 8774846 missense probably benign 0.13
R6008:Taf6l UTSW 19 8778166 missense possibly damaging 0.65
R6091:Taf6l UTSW 19 8778556 missense probably benign 0.04
R6228:Taf6l UTSW 19 8778666 missense probably benign 0.01
R6569:Taf6l UTSW 19 8772710 missense probably damaging 1.00
R6768:Taf6l UTSW 19 8774549 missense probably damaging 1.00
R7586:Taf6l UTSW 19 8783846 missense probably damaging 0.99
Z1176:Taf6l UTSW 19 8782544
Predicted Primers PCR Primer
(F):5'- ACCAAGGATCGGACATAGGGTC -3'
(R):5'- GGAATTTCTGAATCAGGGCATG -3'

Sequencing Primer
(F):5'- AAGCACAGGTGTGGGTTCC -3'
(R):5'- CTGAATCAGGGCATGAACATTTAAC -3'
Posted On2015-02-05