Incidental Mutation 'R3106:Stradb'
ID 263032
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene Name STE20-related kinase adaptor beta
Synonyms PRO1038, D1Ucla2, Als2cr2
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 59012681-59034281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59031450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 212 (H212Q)
Ref Sequence ENSEMBL: ENSMUSP00000027185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
AlphaFold Q8K4T3
Predicted Effect possibly damaging
Transcript: ENSMUST00000027185
AA Change: H212Q

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: H212Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054653
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect unknown
Transcript: ENSMUST00000152318
AA Change: H55Q
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 59,027,688 (GRCm39) missense probably damaging 0.98
IGL00843:Stradb APN 1 59,033,568 (GRCm39) missense probably benign
IGL01288:Stradb APN 1 59,031,460 (GRCm39) missense possibly damaging 0.61
IGL02045:Stradb APN 1 59,028,937 (GRCm39) missense probably damaging 1.00
IGL02818:Stradb APN 1 59,019,121 (GRCm39) missense probably damaging 0.99
P0047:Stradb UTSW 1 59,028,957 (GRCm39) missense probably null 0.86
R0739:Stradb UTSW 1 59,016,174 (GRCm39) unclassified probably benign
R0970:Stradb UTSW 1 59,016,219 (GRCm39) missense possibly damaging 0.92
R1809:Stradb UTSW 1 59,033,549 (GRCm39) missense possibly damaging 0.54
R1930:Stradb UTSW 1 59,030,264 (GRCm39) missense probably benign 0.07
R1931:Stradb UTSW 1 59,030,264 (GRCm39) missense probably benign 0.07
R1932:Stradb UTSW 1 59,030,264 (GRCm39) missense probably benign 0.07
R2570:Stradb UTSW 1 59,027,743 (GRCm39) missense probably damaging 1.00
R2919:Stradb UTSW 1 59,031,828 (GRCm39) missense probably benign 0.44
R3104:Stradb UTSW 1 59,031,450 (GRCm39) missense possibly damaging 0.86
R3105:Stradb UTSW 1 59,031,450 (GRCm39) missense possibly damaging 0.86
R3772:Stradb UTSW 1 59,024,544 (GRCm39) missense probably benign 0.04
R4120:Stradb UTSW 1 59,019,168 (GRCm39) missense possibly damaging 0.92
R4417:Stradb UTSW 1 59,033,531 (GRCm39) missense probably benign
R4569:Stradb UTSW 1 59,019,117 (GRCm39) nonsense probably null
R4601:Stradb UTSW 1 59,032,731 (GRCm39) missense probably damaging 0.98
R4758:Stradb UTSW 1 59,027,730 (GRCm39) missense probably benign 0.02
R4786:Stradb UTSW 1 59,030,367 (GRCm39) intron probably benign
R4944:Stradb UTSW 1 59,019,599 (GRCm39) missense probably benign 0.27
R5113:Stradb UTSW 1 59,030,333 (GRCm39) intron probably benign
R5568:Stradb UTSW 1 59,031,901 (GRCm39) missense possibly damaging 0.72
R5765:Stradb UTSW 1 59,031,903 (GRCm39) missense probably benign 0.31
R5970:Stradb UTSW 1 59,019,175 (GRCm39) critical splice donor site probably null
R6234:Stradb UTSW 1 59,027,707 (GRCm39) missense probably damaging 1.00
R7411:Stradb UTSW 1 59,027,677 (GRCm39) missense possibly damaging 0.95
R7511:Stradb UTSW 1 59,032,108 (GRCm39) missense probably damaging 0.97
R7569:Stradb UTSW 1 59,030,310 (GRCm39) missense unknown
R7575:Stradb UTSW 1 59,027,739 (GRCm39) missense probably benign 0.00
R7646:Stradb UTSW 1 59,033,567 (GRCm39) missense probably benign 0.14
R7658:Stradb UTSW 1 59,031,885 (GRCm39) missense probably damaging 0.96
R8306:Stradb UTSW 1 59,030,356 (GRCm39) missense unknown
R8812:Stradb UTSW 1 59,033,478 (GRCm39) missense probably benign 0.16
Z1176:Stradb UTSW 1 59,032,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACACTGCTGTTTTATAAAGG -3'
(R):5'- GTCTTGTGGCAGCCATTCAC -3'

Sequencing Primer
(F):5'- TCCGAGGGAATATGAGGATATGTTC -3'
(R):5'- AGGACACAGCTGTCCTTT -3'
Posted On 2015-02-05