Incidental Mutation 'R3106:Col6a3'
ID 263033
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Name collagen, type VI, alpha 3
Synonyms Col6a-3
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 90694582-90771710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90744024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 515 (R515G)
Ref Sequence ENSEMBL: ENSMUSP00000057131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
AlphaFold no structure available at present
PDB Structure Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056925
AA Change: R515G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: R515G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097653
AA Change: R108G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: R108G

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
AA Change: R515G

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: R515G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188587
AA Change: R108G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: R108G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90,755,977 (GRCm39) missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90,709,748 (GRCm39) missense unknown
IGL00541:Col6a3 APN 1 90,729,864 (GRCm39) missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90,730,054 (GRCm39) missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90,731,655 (GRCm39) missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90,735,232 (GRCm39) missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90,730,236 (GRCm39) missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90,706,884 (GRCm39) missense unknown
IGL01827:Col6a3 APN 1 90,730,041 (GRCm39) missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90,724,293 (GRCm39) missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90,700,770 (GRCm39) missense unknown
IGL01900:Col6a3 APN 1 90,722,732 (GRCm39) critical splice donor site probably null
IGL01925:Col6a3 APN 1 90,729,958 (GRCm39) missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90,709,858 (GRCm39) splice site probably benign
IGL02115:Col6a3 APN 1 90,735,373 (GRCm39) missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90,709,482 (GRCm39) missense unknown
IGL02313:Col6a3 APN 1 90,739,328 (GRCm39) missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90,706,919 (GRCm39) missense unknown
IGL02821:Col6a3 APN 1 90,731,600 (GRCm39) missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90,724,281 (GRCm39) missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90,739,242 (GRCm39) nonsense probably null
IGL03129:Col6a3 APN 1 90,749,584 (GRCm39) missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90,731,615 (GRCm39) missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90,755,588 (GRCm39) missense probably benign 0.33
IGL03251:Col6a3 APN 1 90,737,898 (GRCm39) missense probably damaging 1.00
bailey UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
barnum UTSW 1 90,706,874 (GRCm39) missense unknown
Boneless UTSW 1 90,706,781 (GRCm39) missense unknown
Noodloid UTSW 1 90,707,011 (GRCm39) missense unknown
randolf UTSW 1 90,715,673 (GRCm39) missense unknown
stringy UTSW 1 90,731,400 (GRCm39) nonsense probably null
wonder UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
ANU05:Col6a3 UTSW 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90,737,970 (GRCm39) missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90,706,516 (GRCm39) missense unknown
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90,725,883 (GRCm39) missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90,741,273 (GRCm39) missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90,725,895 (GRCm39) missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90,735,426 (GRCm39) missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90,755,771 (GRCm39) missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R0512:Col6a3 UTSW 1 90,749,520 (GRCm39) intron probably benign
R0564:Col6a3 UTSW 1 90,735,456 (GRCm39) missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90,735,808 (GRCm39) splice site probably null
R0667:Col6a3 UTSW 1 90,755,823 (GRCm39) missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90,706,703 (GRCm39) missense unknown
R0736:Col6a3 UTSW 1 90,731,811 (GRCm39) missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90,756,020 (GRCm39) missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90,730,375 (GRCm39) missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90,722,047 (GRCm39) missense probably null 1.00
R1169:Col6a3 UTSW 1 90,749,736 (GRCm39) missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1225:Col6a3 UTSW 1 90,739,238 (GRCm39) missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90,696,069 (GRCm39) missense unknown
R1387:Col6a3 UTSW 1 90,750,138 (GRCm39) intron probably benign
R1437:Col6a3 UTSW 1 90,729,098 (GRCm39) missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1677:Col6a3 UTSW 1 90,749,583 (GRCm39) missense probably benign 0.14
R1681:Col6a3 UTSW 1 90,701,224 (GRCm39) missense unknown
R1711:Col6a3 UTSW 1 90,757,935 (GRCm39) missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90,724,296 (GRCm39) critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90,706,781 (GRCm39) missense unknown
R1738:Col6a3 UTSW 1 90,744,083 (GRCm39) missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90,741,516 (GRCm39) missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90,755,671 (GRCm39) missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90,757,936 (GRCm39) missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1895:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1908:Col6a3 UTSW 1 90,739,421 (GRCm39) missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90,750,081 (GRCm39) missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90,731,897 (GRCm39) missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90,709,733 (GRCm39) missense unknown
R2121:Col6a3 UTSW 1 90,738,087 (GRCm39) missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90,731,467 (GRCm39) missense probably benign 0.09
R2448:Col6a3 UTSW 1 90,741,080 (GRCm39) missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90,731,435 (GRCm39) missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90,703,321 (GRCm39) missense unknown
R3052:Col6a3 UTSW 1 90,729,852 (GRCm39) missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3419:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3837:Col6a3 UTSW 1 90,707,803 (GRCm39) missense unknown
R4007:Col6a3 UTSW 1 90,730,291 (GRCm39) missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90,749,605 (GRCm39) missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90,729,105 (GRCm39) missense probably benign 0.28
R4244:Col6a3 UTSW 1 90,714,361 (GRCm39) missense unknown
R4297:Col6a3 UTSW 1 90,739,100 (GRCm39) missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90,749,736 (GRCm39) missense probably benign 0.23
R4600:Col6a3 UTSW 1 90,709,626 (GRCm39) missense unknown
R4683:Col6a3 UTSW 1 90,701,179 (GRCm39) missense unknown
R4788:Col6a3 UTSW 1 90,700,672 (GRCm39) critical splice donor site probably null
R4851:Col6a3 UTSW 1 90,707,011 (GRCm39) missense unknown
R4899:Col6a3 UTSW 1 90,730,149 (GRCm39) missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90,729,164 (GRCm39) missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90,735,246 (GRCm39) missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90,731,940 (GRCm39) missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90,706,565 (GRCm39) missense unknown
R5057:Col6a3 UTSW 1 90,743,852 (GRCm39) missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90,707,074 (GRCm39) missense unknown
R5105:Col6a3 UTSW 1 90,725,862 (GRCm39) missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90,696,067 (GRCm39) missense unknown
R5166:Col6a3 UTSW 1 90,738,330 (GRCm39) missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90,701,361 (GRCm39) nonsense probably null
R5196:Col6a3 UTSW 1 90,744,260 (GRCm39) splice site probably null
R5230:Col6a3 UTSW 1 90,716,776 (GRCm39) missense unknown
R5268:Col6a3 UTSW 1 90,712,965 (GRCm39) missense unknown
R5381:Col6a3 UTSW 1 90,703,334 (GRCm39) missense unknown
R5392:Col6a3 UTSW 1 90,729,017 (GRCm39) missense probably benign 0.41
R5445:Col6a3 UTSW 1 90,709,761 (GRCm39) nonsense probably null
R5571:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R5665:Col6a3 UTSW 1 90,755,602 (GRCm39) missense probably benign 0.00
R5902:Col6a3 UTSW 1 90,729,921 (GRCm39) splice site probably null
R5914:Col6a3 UTSW 1 90,703,922 (GRCm39) missense unknown
R5955:Col6a3 UTSW 1 90,739,163 (GRCm39) missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90,749,571 (GRCm39) missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90,696,105 (GRCm39) missense unknown
R6010:Col6a3 UTSW 1 90,701,219 (GRCm39) missense unknown
R6025:Col6a3 UTSW 1 90,755,824 (GRCm39) missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90,741,475 (GRCm39) missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90,701,387 (GRCm39) missense unknown
R6181:Col6a3 UTSW 1 90,744,096 (GRCm39) missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90,750,063 (GRCm39) missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90,749,955 (GRCm39) missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90,738,285 (GRCm39) missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90,709,534 (GRCm39) missense unknown
R6484:Col6a3 UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
R6701:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6702:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6703:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6703:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6724:Col6a3 UTSW 1 90,706,874 (GRCm39) missense unknown
R6746:Col6a3 UTSW 1 90,706,767 (GRCm39) missense unknown
R6797:Col6a3 UTSW 1 90,731,810 (GRCm39) missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90,722,731 (GRCm39) splice site probably null
R6903:Col6a3 UTSW 1 90,721,929 (GRCm39) missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90,743,724 (GRCm39) missense probably benign 0.00
R6978:Col6a3 UTSW 1 90,735,192 (GRCm39) critical splice donor site probably null
R7058:Col6a3 UTSW 1 90,755,759 (GRCm39) nonsense probably null
R7182:Col6a3 UTSW 1 90,731,400 (GRCm39) nonsense probably null
R7294:Col6a3 UTSW 1 90,756,005 (GRCm39) missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90,755,708 (GRCm39) missense probably benign 0.00
R7311:Col6a3 UTSW 1 90,750,013 (GRCm39) missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90,755,855 (GRCm39) missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90,703,463 (GRCm39) missense unknown
R7575:Col6a3 UTSW 1 90,738,321 (GRCm39) missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90,709,467 (GRCm39) missense unknown
R7679:Col6a3 UTSW 1 90,739,473 (GRCm39) missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90,724,268 (GRCm39) nonsense probably null
R7855:Col6a3 UTSW 1 90,738,343 (GRCm39) missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R8003:Col6a3 UTSW 1 90,703,455 (GRCm39) missense unknown
R8007:Col6a3 UTSW 1 90,705,179 (GRCm39) missense unknown
R8098:Col6a3 UTSW 1 90,731,383 (GRCm39) missense probably benign
R8312:Col6a3 UTSW 1 90,741,412 (GRCm39) missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90,729,935 (GRCm39) missense probably damaging 1.00
R8723:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8725:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8737:Col6a3 UTSW 1 90,727,747 (GRCm39) missense probably benign 0.10
R8742:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8743:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8744:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8753:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8754:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8773:Col6a3 UTSW 1 90,696,171 (GRCm39) missense unknown
R8857:Col6a3 UTSW 1 90,703,485 (GRCm39) missense unknown
R8867:Col6a3 UTSW 1 90,715,673 (GRCm39) missense unknown
R8887:Col6a3 UTSW 1 90,755,948 (GRCm39) missense probably benign
R9011:Col6a3 UTSW 1 90,710,057 (GRCm39) splice site probably benign
R9049:Col6a3 UTSW 1 90,707,066 (GRCm39) missense unknown
R9142:Col6a3 UTSW 1 90,706,566 (GRCm39) missense unknown
R9155:Col6a3 UTSW 1 90,738,301 (GRCm39) missense probably benign 0.27
R9249:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9258:Col6a3 UTSW 1 90,700,703 (GRCm39) missense unknown
R9274:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9276:Col6a3 UTSW 1 90,735,403 (GRCm39) missense possibly damaging 0.94
R9315:Col6a3 UTSW 1 90,738,979 (GRCm39) critical splice donor site probably null
R9376:Col6a3 UTSW 1 90,709,523 (GRCm39) missense unknown
R9377:Col6a3 UTSW 1 90,743,961 (GRCm39) missense probably damaging 1.00
R9429:Col6a3 UTSW 1 90,731,585 (GRCm39) missense probably benign 0.01
R9439:Col6a3 UTSW 1 90,744,155 (GRCm39) missense probably damaging 1.00
R9440:Col6a3 UTSW 1 90,707,068 (GRCm39) missense unknown
R9441:Col6a3 UTSW 1 90,705,249 (GRCm39) nonsense probably null
R9477:Col6a3 UTSW 1 90,706,621 (GRCm39) missense unknown
R9498:Col6a3 UTSW 1 90,713,650 (GRCm39) nonsense probably null
R9528:Col6a3 UTSW 1 90,731,789 (GRCm39) missense probably damaging 1.00
R9602:Col6a3 UTSW 1 90,731,497 (GRCm39) missense probably benign 0.07
RF005:Col6a3 UTSW 1 90,738,984 (GRCm39) missense probably benign 0.00
RF012:Col6a3 UTSW 1 90,738,282 (GRCm39) missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90,731,359 (GRCm39) critical splice donor site probably null
X0063:Col6a3 UTSW 1 90,731,627 (GRCm39) missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90,739,251 (GRCm39) missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90,739,450 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGATGCTGCCTCTCTTCAG -3'
(R):5'- ACATAGTCTTCCTGGTGGATGG -3'

Sequencing Primer
(F):5'- TCTTCAGCTCCTGGGCAG -3'
(R):5'- CCTGGGGCCATCCAACTTC -3'
Posted On 2015-02-05