Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Col6a3'

263033

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

040580-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90765923-90843971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90816302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 515 (R515G)

Ref Sequence

ENSEMBL: ENSMUSP00000057131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056925
AA Change: R515G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: R515G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097653
AA Change: R108G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: R108G

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130846
AA Change: R515G

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: R515G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188587
AA Change: R108G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: R108G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90828255	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90782026	missense	unknown
IGL00541:Col6a3	APN	1	90802142	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90802332	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90803933	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90807510	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90802292	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90802514	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90779162	missense	unknown
IGL01827:Col6a3	APN	1	90802319	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90796571	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90773048	missense	unknown
IGL01900:Col6a3	APN	1	90795010	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90802236	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90782136	splice site	probably benign
IGL02115:Col6a3	APN	1	90807651	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90781760	missense	unknown
IGL02313:Col6a3	APN	1	90811606	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90779197	missense	unknown
IGL02821:Col6a3	APN	1	90803878	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90796559	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90811520	nonsense	probably null
IGL03129:Col6a3	APN	1	90821862	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90803893	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90827866	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90810176	missense	probably damaging	1.00
bailey	UTSW	1	90767606	critical splice acceptor site	probably benign
barnum	UTSW	1	90779152	missense	unknown
Boneless	UTSW	1	90779059	missense	unknown
Noodloid	UTSW	1	90779289	missense	unknown
randolf	UTSW	1	90787951	missense	unknown
stringy	UTSW	1	90803678	nonsense	probably null
wonder	UTSW	1	90791923	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90802292	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90810248	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90778794	missense	unknown
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90798161	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90813551	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90798173	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90807704	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90828049	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90788216	missense	unknown
R0512:Col6a3	UTSW	1	90821798	intron	probably benign
R0564:Col6a3	UTSW	1	90807734	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90808086	splice site	probably null
R0667:Col6a3	UTSW	1	90828101	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90778981	missense	unknown
R0736:Col6a3	UTSW	1	90804089	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90828298	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90802653	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90794325	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90822014	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90781855	missense	unknown
R1225:Col6a3	UTSW	1	90811516	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90768347	missense	unknown
R1387:Col6a3	UTSW	1	90822416	intron	probably benign
R1437:Col6a3	UTSW	1	90801376	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90781855	missense	unknown
R1677:Col6a3	UTSW	1	90821861	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90773502	missense	unknown
R1711:Col6a3	UTSW	1	90830213	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90796574	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90779059	missense	unknown
R1738:Col6a3	UTSW	1	90816361	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90813794	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90827949	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90830214	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90811699	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90822359	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90804175	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90782011	missense	unknown
R2121:Col6a3	UTSW	1	90810365	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90803745	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90813358	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90803713	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90775599	missense	unknown
R3052:Col6a3	UTSW	1	90802130	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90780081	missense	unknown
R4007:Col6a3	UTSW	1	90802569	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90821883	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90801383	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90786639	missense	unknown
R4297:Col6a3	UTSW	1	90811378	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90822014	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90781904	missense	unknown
R4683:Col6a3	UTSW	1	90773457	missense	unknown
R4788:Col6a3	UTSW	1	90772950	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90779289	missense	unknown
R4899:Col6a3	UTSW	1	90802427	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90801442	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90807524	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90804218	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90778843	missense	unknown
R5057:Col6a3	UTSW	1	90816130	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90779352	missense	unknown
R5105:Col6a3	UTSW	1	90798140	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90768345	missense	unknown
R5166:Col6a3	UTSW	1	90810608	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90773639	nonsense	probably null
R5196:Col6a3	UTSW	1	90816538	splice site	probably null
R5230:Col6a3	UTSW	1	90789054	missense	unknown
R5268:Col6a3	UTSW	1	90785243	missense	unknown
R5381:Col6a3	UTSW	1	90775612	missense	unknown
R5392:Col6a3	UTSW	1	90801295	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90782039	nonsense	probably null
R5571:Col6a3	UTSW	1	90788216	missense	unknown
R5665:Col6a3	UTSW	1	90827880	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90802199	splice site	probably null
R5914:Col6a3	UTSW	1	90776200	missense	unknown
R5955:Col6a3	UTSW	1	90811441	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90821849	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90768383	missense	unknown
R6010:Col6a3	UTSW	1	90773497	missense	unknown
R6025:Col6a3	UTSW	1	90828102	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90813753	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90773665	missense	unknown
R6181:Col6a3	UTSW	1	90816374	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90822341	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90822233	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90810563	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90781812	missense	unknown
R6484:Col6a3	UTSW	1	90791923	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6724:Col6a3	UTSW	1	90779152	missense	unknown
R6746:Col6a3	UTSW	1	90779045	missense	unknown
R6797:Col6a3	UTSW	1	90804088	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90795009	splice site	probably null
R6903:Col6a3	UTSW	1	90794207	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90816002	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90807470	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90828037	nonsense	probably null
R7182:Col6a3	UTSW	1	90803678	nonsense	probably null
R7294:Col6a3	UTSW	1	90828283	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90827986	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90822291	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90828133	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90775741	missense	unknown
R7575:Col6a3	UTSW	1	90810599	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90781745	missense	unknown
R7679:Col6a3	UTSW	1	90811751	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90796546	nonsense	probably null
R7855:Col6a3	UTSW	1	90810621	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90781855	missense	unknown
R8003:Col6a3	UTSW	1	90775733	missense	unknown
R8007:Col6a3	UTSW	1	90777457	missense	unknown
R8098:Col6a3	UTSW	1	90803661	missense	probably benign
R8312:Col6a3	UTSW	1	90813690	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90802213	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90800025	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90768449	missense	unknown
R8857:Col6a3	UTSW	1	90775763	missense	unknown
R8867:Col6a3	UTSW	1	90787951	missense	unknown
R8887:Col6a3	UTSW	1	90828226	missense	probably benign
R9011:Col6a3	UTSW	1	90782335	splice site	probably benign
R9049:Col6a3	UTSW	1	90779344	missense	unknown
R9142:Col6a3	UTSW	1	90778844	missense	unknown
R9155:Col6a3	UTSW	1	90810579	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90779298	missense	unknown
R9258:Col6a3	UTSW	1	90772981	missense	unknown
R9274:Col6a3	UTSW	1	90779298	missense	unknown
R9276:Col6a3	UTSW	1	90807681	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90811257	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90781801	missense	unknown
R9377:Col6a3	UTSW	1	90816239	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90803863	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90816433	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90779346	missense	unknown
R9441:Col6a3	UTSW	1	90777527	nonsense	probably null
R9477:Col6a3	UTSW	1	90778899	missense	unknown
R9498:Col6a3	UTSW	1	90785928	nonsense	probably null
R9528:Col6a3	UTSW	1	90804067	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90803775	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90811262	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90810560	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90803637	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90803905	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90811529	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90811728	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ATGATGCTGCCTCTCTTCAG -3'
(R):5'- ACATAGTCTTCCTGGTGGATGG -3'

Sequencing Primer
(F):5'- TCTTCAGCTCCTGGGCAG -3'
(R):5'- CCTGGGGCCATCCAACTTC -3'

Posted On

2015-02-05