Incidental Mutation 'R3106:Atp5f1c'
ID 263034
Institutional Source Beutler Lab
Gene Symbol Atp5f1c
Ensembl Gene ENSMUSG00000025781
Gene Name ATP synthase F1 subunit gamma
Synonyms Atp5c1, 1700094F02Rik, F1 gamma
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10060841-10085321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10068276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000110546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]
AlphaFold Q91VR2
Predicted Effect probably benign
Transcript: ENSMUST00000026887
AA Change: S184P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: S184P

DomainStartEndE-ValueType
Pfam:ATP-synt 26 297 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114896
AA Change: S160P

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 273 1.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114897
AA Change: S184P

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: S184P

DomainStartEndE-ValueType
Pfam:ATP-synt 27 297 6.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130067
SMART Domains Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781

DomainStartEndE-ValueType
Pfam:ATP-synt 2 101 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139810
SMART Domains Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781

DomainStartEndE-ValueType
Pfam:ATP-synt 2 153 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145530
AA Change: S160P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 187 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153554
AA Change: S160P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 171 1.2e-43 PFAM
Meta Mutation Damage Score 0.2524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Atp5f1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Atp5f1c APN 2 10,073,477 (GRCm39) missense probably damaging 1.00
R4651:Atp5f1c UTSW 2 10,068,287 (GRCm39) missense probably damaging 1.00
R4670:Atp5f1c UTSW 2 10,064,428 (GRCm39) missense probably damaging 1.00
R5097:Atp5f1c UTSW 2 10,068,323 (GRCm39) missense probably benign 0.01
R5275:Atp5f1c UTSW 2 10,073,544 (GRCm39) missense possibly damaging 0.51
R5295:Atp5f1c UTSW 2 10,073,544 (GRCm39) missense possibly damaging 0.51
R6195:Atp5f1c UTSW 2 10,068,926 (GRCm39) missense possibly damaging 0.79
R6536:Atp5f1c UTSW 2 10,085,127 (GRCm39) unclassified probably benign
R9050:Atp5f1c UTSW 2 10,069,049 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGGTCTCCTGACACAC -3'
(R):5'- GCTATTTTCTTACAGCACAGTGTC -3'

Sequencing Primer
(F):5'- TACCAGCAGTCGCAATGGTATTC -3'
(R):5'- TTACAGCACAGTGTCTCATTAACC -3'
Posted On 2015-02-05