Incidental Mutation 'R3106:Trp53bp1'
ID 263037
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Name transformation related protein 53 binding protein 1
Synonyms 53BP1, p53BP1
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 121023762-121101888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121067133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 531 (L531S)
Ref Sequence ENSEMBL: ENSMUSP00000114457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
AlphaFold P70399
Predicted Effect probably damaging
Transcript: ENSMUST00000110647
AA Change: L531S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: L531S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110648
AA Change: L531S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: L531S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124031
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably damaging
Transcript: ENSMUST00000131245
AA Change: L531S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: L531S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142400
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121,087,060 (GRCm39) missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121,066,476 (GRCm39) missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121,038,963 (GRCm39) missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121,100,800 (GRCm39) splice site probably null
IGL01639:Trp53bp1 APN 2 121,033,173 (GRCm39) missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121,066,506 (GRCm39) missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121,041,785 (GRCm39) missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121,046,377 (GRCm39) missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121,067,070 (GRCm39) missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121,029,555 (GRCm39) missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121,033,191 (GRCm39) missense possibly damaging 0.67
chives UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
concur UTSW 2 121,100,800 (GRCm39) splice site probably null
confirmation UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
Infra UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
Legume UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
lentil UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
lentil2 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
Profundus UTSW 2 121,038,284 (GRCm39) missense probably damaging 1.00
split_pea UTSW 2 121,059,087 (GRCm39) nonsense probably null
verily UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121,101,756 (GRCm39) missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121,034,978 (GRCm39) missense probably benign
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121,100,718 (GRCm39) missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121,035,424 (GRCm39) missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121,066,498 (GRCm39) missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121,100,450 (GRCm39) missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121,058,282 (GRCm39) missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121,058,653 (GRCm39) splice site probably benign
R0593:Trp53bp1 UTSW 2 121,101,009 (GRCm39) missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121,066,188 (GRCm39) missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121,078,745 (GRCm39) missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121,034,799 (GRCm39) splice site probably benign
R1377:Trp53bp1 UTSW 2 121,101,123 (GRCm39) missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121,066,665 (GRCm39) missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121,082,481 (GRCm39) missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121,035,517 (GRCm39) missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121,034,964 (GRCm39) missense probably benign
R2143:Trp53bp1 UTSW 2 121,046,545 (GRCm39) missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121,100,754 (GRCm39) nonsense probably null
R2296:Trp53bp1 UTSW 2 121,039,728 (GRCm39) missense possibly damaging 0.96
R3792:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121,059,107 (GRCm39) missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121,035,566 (GRCm39) missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121,087,131 (GRCm39) missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121,038,432 (GRCm39) missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121,058,290 (GRCm39) missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121,038,360 (GRCm39) missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121,059,087 (GRCm39) nonsense probably null
R4850:Trp53bp1 UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121,087,122 (GRCm39) missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121,033,084 (GRCm39) missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121,051,701 (GRCm39) nonsense probably null
R4962:Trp53bp1 UTSW 2 121,101,027 (GRCm39) missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121,100,800 (GRCm39) splice site probably null
R5111:Trp53bp1 UTSW 2 121,041,868 (GRCm39) missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121,046,598 (GRCm39) missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121,074,464 (GRCm39) missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121,038,227 (GRCm39) missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121,067,143 (GRCm39) missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121,074,395 (GRCm39) missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121,038,873 (GRCm39) nonsense probably null
R5886:Trp53bp1 UTSW 2 121,035,502 (GRCm39) missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121,067,304 (GRCm39) missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121,087,083 (GRCm39) missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121,100,426 (GRCm39) missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121,101,093 (GRCm39) missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121,059,084 (GRCm39) missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121,038,284 (GRCm39) missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121,101,057 (GRCm39) missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121,039,790 (GRCm39) missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121,059,147 (GRCm39) missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121,029,594 (GRCm39) missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121,038,521 (GRCm39) missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121,029,516 (GRCm39) missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121,066,950 (GRCm39) missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121,041,781 (GRCm39) missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121,066,827 (GRCm39) missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121,067,119 (GRCm39) missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121,078,295 (GRCm39) splice site probably null
R7728:Trp53bp1 UTSW 2 121,038,380 (GRCm39) missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121,035,542 (GRCm39) missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121,066,225 (GRCm39) missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121,030,230 (GRCm39) missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
R9136:Trp53bp1 UTSW 2 121,067,092 (GRCm39) missense possibly damaging 0.84
R9152:Trp53bp1 UTSW 2 121,029,056 (GRCm39) missense probably damaging 0.99
R9292:Trp53bp1 UTSW 2 121,046,177 (GRCm39) missense probably damaging 0.97
R9340:Trp53bp1 UTSW 2 121,100,460 (GRCm39) missense probably benign 0.40
R9475:Trp53bp1 UTSW 2 121,039,761 (GRCm39) missense probably benign 0.00
R9616:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.30
R9675:Trp53bp1 UTSW 2 121,087,089 (GRCm39) missense probably benign 0.03
R9779:Trp53bp1 UTSW 2 121,066,469 (GRCm39) missense probably damaging 1.00
RF046:Trp53bp1 UTSW 2 121,046,482 (GRCm39) frame shift probably null
Z1088:Trp53bp1 UTSW 2 121,084,126 (GRCm39) missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121,074,541 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACATCTTCAGCAACCGCGTC -3'
(R):5'- TTCCATCACCAAGTCTGGAAG -3'

Sequencing Primer
(F):5'- AGCAACCGCGTCTTCTCTG -3'
(R):5'- CATCAGATGATGTGAAGAAAGGTG -3'
Posted On 2015-02-05