Incidental Mutation 'R3106:Vmn2r-ps159'
ID263047
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R3106 (G1)
Quality Score158
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 156333435 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTGCTATCGATGAGATCAACAGG -3'
(R):5'- GAACTCAGTTTTACCTGTTTGCAC -3'

Sequencing Primer
(F):5'- CGATGAGATCAACAGGAATCCTTATC -3'
(R):5'- CTGTTTGCACAGTACATCTATGAAC -3'
Posted On2015-02-05