Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Clip2'

263052

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

WSCR4, Cyln2, CLIP-115

MMRRC Submission

040580-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134489383-134552434 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134523064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 68 (K68R)

Ref Sequence

ENSEMBL: ENSMUSP00000098212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

AlphaFold

Q9Z0H8

Predicted Effect

probably benign
Transcript: ENSMUST00000036999
AA Change: K68R

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: K68R

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100647
AA Change: K68R

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: K68R

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202895

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134500157	splice site	probably benign
IGL01024:Clip2	APN	5	134510212	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134492350	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134522664	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134498084	splice site	probably benign
IGL02174:Clip2	APN	5	134494264	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134503130	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134502571	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134518022	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134510159	splice site	probably benign
IGL03198:Clip2	APN	5	134498082	splice site	probably benign
IGL03269:Clip2	APN	5	134516894	missense	probably damaging	1.00
scissors	UTSW	5	134517999	nonsense	probably null
R0335:Clip2	UTSW	5	134535215	start gained	probably benign
R0422:Clip2	UTSW	5	134498113	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134516151	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134492250	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134503253	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134502929	nonsense	probably null
R1822:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134503115	missense	probably damaging	1.00
R3890:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134492253	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134535197	start gained	probably benign
R4239:Clip2	UTSW	5	134535197	start gained	probably benign
R4294:Clip2	UTSW	5	134492313	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134502953	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134516269	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134514048	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134502779	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134491925	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134522630	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134496241	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134502917	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134502630	nonsense	probably null
R7725:Clip2	UTSW	5	134517999	nonsense	probably null
R8380:Clip2	UTSW	5	134502797	missense	probably damaging	0.96
R8680:Clip2	UTSW	5	134502608	missense	probably benign
R9095:Clip2	UTSW	5	134503400	missense	possibly damaging	0.93
R9158:Clip2	UTSW	5	134492397	missense	probably benign	0.00
R9277:Clip2	UTSW	5	134500109	missense	probably benign
R9300:Clip2	UTSW	5	134498088	critical splice donor site	probably null
R9457:Clip2	UTSW	5	134502730	missense	probably benign	0.00
R9491:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9605:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9630:Clip2	UTSW	5	134503080	missense	probably damaging	1.00
R9657:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9660:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9661:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9662:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9663:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9730:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9731:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9732:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9773:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9787:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9788:Clip2	UTSW	5	134504762	missense	probably benign	0.04
X0062:Clip2	UTSW	5	134503136	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134516835	missense	probably damaging	0.98
Z1177:Clip2	UTSW	5	134522999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGATGCCCTGTAGAGCC -3'
(R):5'- GCTGCCTCAGTTTCCCTAAGATAAC -3'

Sequencing Primer
(F):5'- ACTCGAAGTAGCGCACG -3'
(R):5'- AGTTTCCCTAAGATAACTATCACCG -3'

Posted On

2015-02-05