Incidental Mutation 'R3106:Pan3'
ID 263053
Institutional Source Beutler Lab
Gene Symbol Pan3
Ensembl Gene ENSMUSG00000029647
Gene Name PAN3 poly(A) specific ribonuclease subunit
Synonyms 2700050F09Rik, A430027N15Rik
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.385) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 147366971-147485312 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 147476189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031651] [ENSMUST00000175807] [ENSMUST00000176553] [ENSMUST00000176600]
AlphaFold Q640Q5
Predicted Effect probably benign
Transcript: ENSMUST00000031651
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175807
SMART Domains Protein: ENSMUSP00000135729
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
PDB:4BWP|B 51 450 1e-134 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176505
Predicted Effect probably benign
Transcript: ENSMUST00000176553
SMART Domains Protein: ENSMUSP00000134911
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
PDB:4BWP|B 1 142 5e-66 PDB
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176596
Predicted Effect probably benign
Transcript: ENSMUST00000176600
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176856
Predicted Effect probably benign
Transcript: ENSMUST00000177465
SMART Domains Protein: ENSMUSP00000134810
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176753
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177496
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
Allele List at MGI

 All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Pan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Pan3 APN 5 147,466,783 (GRCm39) missense probably benign 0.05
IGL01612:Pan3 APN 5 147,390,052 (GRCm39) splice site probably benign
IGL02187:Pan3 APN 5 147,463,398 (GRCm39) missense probably benign 0.21
IGL02324:Pan3 APN 5 147,466,933 (GRCm39) splice site probably null
IGL02328:Pan3 APN 5 147,466,933 (GRCm39) splice site probably null
IGL02507:Pan3 APN 5 147,463,406 (GRCm39) missense probably damaging 0.98
IGL03144:Pan3 APN 5 147,387,591 (GRCm39) splice site probably benign
3-1:Pan3 UTSW 5 147,463,385 (GRCm39) missense probably benign 0.14
R2145:Pan3 UTSW 5 147,466,908 (GRCm39) missense possibly damaging 0.87
R2174:Pan3 UTSW 5 147,387,463 (GRCm39) missense possibly damaging 0.63
R2504:Pan3 UTSW 5 147,463,846 (GRCm39) missense possibly damaging 0.87
R3723:Pan3 UTSW 5 147,440,018 (GRCm39) intron probably benign
R3944:Pan3 UTSW 5 147,387,540 (GRCm39) missense probably damaging 1.00
R4589:Pan3 UTSW 5 147,479,983 (GRCm39) missense probably damaging 0.98
R4647:Pan3 UTSW 5 147,464,013 (GRCm39) missense probably damaging 1.00
R4811:Pan3 UTSW 5 147,466,868 (GRCm39) missense probably damaging 1.00
R5001:Pan3 UTSW 5 147,463,492 (GRCm39) critical splice donor site probably null
R5126:Pan3 UTSW 5 147,464,008 (GRCm39) missense probably benign 0.00
R5215:Pan3 UTSW 5 147,391,915 (GRCm39) splice site probably null
R5317:Pan3 UTSW 5 147,480,020 (GRCm39) critical splice donor site probably null
R5496:Pan3 UTSW 5 147,463,938 (GRCm39) critical splice acceptor site probably null
R5687:Pan3 UTSW 5 147,391,982 (GRCm39) missense probably damaging 1.00
R6147:Pan3 UTSW 5 147,485,093 (GRCm39) unclassified probably benign
R6539:Pan3 UTSW 5 147,387,463 (GRCm39) missense possibly damaging 0.63
R7008:Pan3 UTSW 5 147,482,503 (GRCm39) missense probably damaging 0.99
R7047:Pan3 UTSW 5 147,483,175 (GRCm39) missense probably damaging 0.97
R7226:Pan3 UTSW 5 147,463,802 (GRCm39) missense probably damaging 1.00
R7424:Pan3 UTSW 5 147,473,082 (GRCm39) splice site probably null
R7453:Pan3 UTSW 5 147,463,491 (GRCm39) critical splice donor site probably null
R8062:Pan3 UTSW 5 147,463,960 (GRCm39) missense probably benign 0.18
R8786:Pan3 UTSW 5 147,424,951 (GRCm39) missense possibly damaging 0.94
R8897:Pan3 UTSW 5 147,387,472 (GRCm39) missense probably benign 0.23
R9658:Pan3 UTSW 5 147,479,881 (GRCm39) missense probably benign 0.00
X0060:Pan3 UTSW 5 147,479,943 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGCTGACCATTCATG -3'
(R):5'- ACATATGCCTACTTTTGTGCAC -3'

Sequencing Primer
(F):5'- ATTCATGGGGTTCTTCTCTGTC -3'
(R):5'- GCACAGTTGTACTCAGGAGATTATGC -3'
Posted On 2015-02-05