Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Nphs1'

263057

Institutional Source

Beutler Lab

Gene Symbol

Nphs1

Ensembl Gene

ENSMUSG00000006649

Gene Name

nephrosis 1, nephrin

Synonyms

nephrin

MMRRC Submission

040580-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30458315-30487223 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 30467540 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 724 (S724*)

Ref Sequence

ENSEMBL: ENSMUSP00000116500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]

AlphaFold

Q9QZS7

Predicted Effect

probably null
Transcript: ENSMUST00000006825
AA Change: S738*

SMART Domains

Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S738*

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
IG	52	146	1.38e-6	SMART
Pfam:C2-set_2	152	242	4.1e-20	PFAM
IG	264	351	9.86e-3	SMART
IG_like	360	452	2.73e1	SMART
IG	464	556	2.99e-2	SMART
IG_like	572	644	8.9e-1	SMART
IG	667	751	1.32e-3	SMART
IG	760	849	7.3e-6	SMART
IGc2	868	941	5.4e-9	SMART
FN3	955	1036	1.01e-11	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000126297
AA Change: S724*

SMART Domains

Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S724*

Domain	Start	End	E-Value	Type
IG	38	132	1.38e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152625

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Nphs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Nphs1	APN	7	30482551	missense	possibly damaging	0.77
IGL00927:Nphs1	APN	7	30460739	unclassified	probably benign
IGL00976:Nphs1	APN	7	30460685	missense	possibly damaging	0.78
IGL01397:Nphs1	APN	7	30486664	missense	probably benign	0.01
IGL01465:Nphs1	APN	7	30486714	makesense	probably null
IGL01889:Nphs1	APN	7	30460511	missense	probably damaging	1.00
IGL02383:Nphs1	APN	7	30481635	splice site	probably benign
R0020:Nphs1	UTSW	7	30463208	missense	probably benign	0.01
R0485:Nphs1	UTSW	7	30467515	missense	probably benign
R1024:Nphs1	UTSW	7	30474277	missense	probably damaging	1.00
R1115:Nphs1	UTSW	7	30481378	splice site	probably benign
R1144:Nphs1	UTSW	7	30481678	splice site	probably benign
R1289:Nphs1	UTSW	7	30471178	missense	probably damaging	1.00
R1317:Nphs1	UTSW	7	30481831	splice site	probably benign
R1617:Nphs1	UTSW	7	30482531	missense	probably benign
R1756:Nphs1	UTSW	7	30461534	missense	probably benign	0.00
R1937:Nphs1	UTSW	7	30474373	missense	probably damaging	1.00
R2144:Nphs1	UTSW	7	30460970	missense	probably benign	0.13
R2256:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2257:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2277:Nphs1	UTSW	7	30467564	nonsense	probably null
R3104:Nphs1	UTSW	7	30467540	nonsense	probably null
R3151:Nphs1	UTSW	7	30460240	missense	probably benign
R3765:Nphs1	UTSW	7	30471210	missense	probably damaging	0.98
R4078:Nphs1	UTSW	7	30467520	nonsense	probably null
R4397:Nphs1	UTSW	7	30481965	splice site	probably null
R4635:Nphs1	UTSW	7	30468007	missense	probably benign	0.39
R4650:Nphs1	UTSW	7	30482470	missense	probably benign	0.21
R4811:Nphs1	UTSW	7	30460429	missense	probably damaging	1.00
R4850:Nphs1	UTSW	7	30463232	missense	possibly damaging	0.78
R5272:Nphs1	UTSW	7	30481642	missense	possibly damaging	0.86
R5327:Nphs1	UTSW	7	30463825	missense	probably benign	0.00
R5681:Nphs1	UTSW	7	30486625	missense	probably benign	0.00
R5865:Nphs1	UTSW	7	30474385	missense	probably damaging	1.00
R5975:Nphs1	UTSW	7	30466115	missense	possibly damaging	0.82
R6186:Nphs1	UTSW	7	30465634	missense	probably damaging	0.98
R6198:Nphs1	UTSW	7	30467915	missense	probably damaging	0.97
R6353:Nphs1	UTSW	7	30474544	missense	probably damaging	0.99
R7405:Nphs1	UTSW	7	30462828	missense	possibly damaging	0.46
R7647:Nphs1	UTSW	7	30481965	splice site	probably null
R7767:Nphs1	UTSW	7	30463308	missense	probably damaging	1.00
R8132:Nphs1	UTSW	7	30482053	missense	probably benign	0.02
R8485:Nphs1	UTSW	7	30466173	missense	probably damaging	0.98
R8678:Nphs1	UTSW	7	30463859	missense	probably damaging	1.00
R8890:Nphs1	UTSW	7	30462655	missense	probably damaging	1.00
R8946:Nphs1	UTSW	7	30463200	missense	probably damaging	1.00
R9133:Nphs1	UTSW	7	30460667	nonsense	probably null
R9159:Nphs1	UTSW	7	30465601	missense	possibly damaging	0.93
R9347:Nphs1	UTSW	7	30471169	missense	probably damaging	1.00
R9547:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9548:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9607:Nphs1	UTSW	7	30463587	missense	probably damaging	1.00
R9626:Nphs1	UTSW	7	30467566	missense	probably benign	0.16
R9720:Nphs1	UTSW	7	30466074	missense	possibly damaging	0.83
R9733:Nphs1	UTSW	7	30467530	missense	probably damaging	1.00
X0028:Nphs1	UTSW	7	30467504	missense	probably null	0.01
Z1177:Nphs1	UTSW	7	30470903	missense	probably damaging	1.00
Z1186:Nphs1	UTSW	7	30460350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGAGGAGGGTTCAGATTC -3'
(R):5'- CTTGCCCTTTATGGAAGAGAATTCTC -3'

Sequencing Primer
(F):5'- TCAGATTCAGGAGGCTGGGC -3'
(R):5'- AATAAGCCTGTCTTCATCGTTGTG -3'

Posted On

2015-02-05