Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Adamts17'

263060

Institutional Source

Beutler Lab

Gene Symbol

Adamts17

Ensembl Gene

ENSMUSG00000058145

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17

Synonyms

AU023434

MMRRC Submission

040580-MU

Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66839735-67153171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67125072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 980 (S980T)

Ref Sequence

ENSEMBL: ENSMUSP00000103102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]

AlphaFold

E9Q4D1

Predicted Effect

probably damaging
Transcript: ENSMUST00000098382
AA Change: S1007T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: S1007T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107478
AA Change: S980T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: S980T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Meta Mutation Damage Score

0.3416

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Adamts17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Adamts17	APN	7	66968902	missense	probably damaging	1.00
IGL00950:Adamts17	APN	7	67120912	missense	possibly damaging	0.69
IGL01532:Adamts17	APN	7	66908601	missense	probably damaging	1.00
IGL01591:Adamts17	APN	7	67004396	missense	probably damaging	1.00
IGL01602:Adamts17	APN	7	66888411	missense	probably benign	0.29
IGL01640:Adamts17	APN	7	67029680	missense	probably damaging	0.98
IGL01686:Adamts17	APN	7	66840289	missense	probably benign	0.06
IGL01747:Adamts17	APN	7	67052011	missense	probably damaging	1.00
IGL02081:Adamts17	APN	7	67062110	missense	probably damaging	1.00
IGL02152:Adamts17	APN	7	67125000	missense	probably benign	0.01
IGL02264:Adamts17	APN	7	67047459	splice site	probably null
IGL02457:Adamts17	APN	7	67027814	missense	probably damaging	0.99
IGL02519:Adamts17	APN	7	67124973	missense	possibly damaging	0.82
IGL02530:Adamts17	APN	7	66909376	missense	probably damaging	1.00
IGL02649:Adamts17	APN	7	66849878	splice site	probably benign
IGL02711:Adamts17	APN	7	67052040	splice site	probably benign
IGL03006:Adamts17	APN	7	67078347	missense	possibly damaging	0.53
IGL03203:Adamts17	APN	7	67062108	missense	probably damaging	1.00
IGL03343:Adamts17	APN	7	67075316	missense	probably damaging	1.00
BB007:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
BB017:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
E2594:Adamts17	UTSW	7	67004350	missense	probably damaging	1.00
R0380:Adamts17	UTSW	7	67150044	missense	probably benign	0.00
R0416:Adamts17	UTSW	7	66915898	splice site	probably null
R0635:Adamts17	UTSW	7	66908605	missense	probably damaging	1.00
R1083:Adamts17	UTSW	7	67147574	missense	probably damaging	1.00
R1476:Adamts17	UTSW	7	67075343	missense	probably damaging	1.00
R1728:Adamts17	UTSW	7	67149956	nonsense	probably null
R1729:Adamts17	UTSW	7	67149956	nonsense	probably null
R1763:Adamts17	UTSW	7	67147715	missense	probably damaging	1.00
R1784:Adamts17	UTSW	7	67149956	nonsense	probably null
R1905:Adamts17	UTSW	7	67047472	nonsense	probably null
R1938:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3796:Adamts17	UTSW	7	66839914	splice site	probably null
R3849:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3850:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3945:Adamts17	UTSW	7	67120939	missense	probably benign
R4519:Adamts17	UTSW	7	66840566	missense	probably damaging	0.99
R4554:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4555:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4556:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4557:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4700:Adamts17	UTSW	7	67041888	missense	probably damaging	1.00
R4752:Adamts17	UTSW	7	67004470	missense	probably damaging	0.96
R5019:Adamts17	UTSW	7	67062070	nonsense	probably null
R5438:Adamts17	UTSW	7	66888417	missense	probably benign	0.30
R5444:Adamts17	UTSW	7	67041899	missense	probably benign	0.02
R5673:Adamts17	UTSW	7	67041807	missense	probably damaging	1.00
R6326:Adamts17	UTSW	7	67120888	missense	probably benign	0.05
R6964:Adamts17	UTSW	7	66909400	missense	possibly damaging	0.93
R6964:Adamts17	UTSW	7	67004353	missense	probably benign	0.00
R7129:Adamts17	UTSW	7	67121010	missense	probably damaging	1.00
R7317:Adamts17	UTSW	7	66840556	nonsense	probably null
R7355:Adamts17	UTSW	7	67075304	missense
R7386:Adamts17	UTSW	7	66968849	missense	probably benign	0.25
R7407:Adamts17	UTSW	7	67047556	nonsense	probably null
R7432:Adamts17	UTSW	7	67051917	missense
R7782:Adamts17	UTSW	7	67125054	missense	probably damaging	1.00
R7817:Adamts17	UTSW	7	66909476	missense	probably damaging	0.99
R7930:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
R7993:Adamts17	UTSW	7	66849864	missense	possibly damaging	0.90
R8178:Adamts17	UTSW	7	66849716	missense	possibly damaging	0.46
R8962:Adamts17	UTSW	7	67075309	missense	probably damaging	1.00
R9095:Adamts17	UTSW	7	67004369	missense	probably damaging	1.00
R9111:Adamts17	UTSW	7	66839900	missense	probably damaging	0.96
R9303:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9305:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9505:Adamts17	UTSW	7	67124935	missense	probably benign	0.00
R9668:Adamts17	UTSW	7	67147690	missense	possibly damaging	0.61
X0022:Adamts17	UTSW	7	67041901	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TGGCATTGATGGACTTAAACTGAG -3'
(R):5'- CAGTGCAGCTGGTTGGAAAG -3'

Sequencing Primer
(F):5'- CATACAGTGCTCTGCCAA -3'
(R):5'- CTTTGTGAGTTCAAAGCCAACCTGG -3'

Posted On

2015-02-05