Incidental Mutation 'R3106:Plekha7'
ID 263061
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Name pleckstrin homology domain containing, family A member 7
Synonyms A430081P20Rik
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 115722720-115907611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115763639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 321 (R321K)
Ref Sequence ENSEMBL: ENSMUSP00000148936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181981] [ENSMUST00000181998] [ENSMUST00000182487] [ENSMUST00000182511] [ENSMUST00000182834] [ENSMUST00000216517]
AlphaFold Q3UIL6
Predicted Effect probably benign
Transcript: ENSMUST00000084664
AA Change: R85K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659
AA Change: R85K

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181981
AA Change: R216K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138766
Gene: ENSMUSG00000045659
AA Change: R216K

DomainStartEndE-ValueType
PH 59 178 1.42e-18 SMART
low complexity region 231 243 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 453 482 N/A INTRINSIC
coiled coil region 592 631 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 808 824 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181998
AA Change: R321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659
AA Change: R321K

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182443
AA Change: R239K
Predicted Effect probably benign
Transcript: ENSMUST00000182487
AA Change: R321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138214
Gene: ENSMUSG00000045659
AA Change: R321K

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182511
AA Change: R259K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138544
Gene: ENSMUSG00000045659
AA Change: R259K

DomainStartEndE-ValueType
PH 102 221 1.42e-18 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 496 525 N/A INTRINSIC
coiled coil region 635 674 N/A INTRINSIC
coiled coil region 703 736 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
coiled coil region 1002 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182549
Predicted Effect probably benign
Transcript: ENSMUST00000182834
AA Change: R275K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659
AA Change: R275K

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206097
Predicted Effect probably benign
Transcript: ENSMUST00000216517
AA Change: R321K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 115,734,419 (GRCm39) missense probably damaging 1.00
IGL01133:Plekha7 APN 7 115,744,476 (GRCm39) splice site probably null
IGL01146:Plekha7 APN 7 115,756,708 (GRCm39) splice site probably benign
IGL01307:Plekha7 APN 7 115,744,479 (GRCm39) splice site probably benign
IGL02063:Plekha7 APN 7 115,739,936 (GRCm39) missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 115,753,863 (GRCm39) splice site probably null
IGL02420:Plekha7 APN 7 115,757,469 (GRCm39) missense probably damaging 1.00
IGL02660:Plekha7 APN 7 115,756,809 (GRCm39) splice site probably benign
IGL02851:Plekha7 APN 7 115,734,413 (GRCm39) missense probably damaging 1.00
Plexus UTSW 7 115,747,559 (GRCm39) missense probably benign 0.07
R0614_Plekha7_947 UTSW 7 115,753,880 (GRCm39) nonsense probably null
R4750_Plekha7_499 UTSW 7 115,736,546 (GRCm39) missense probably damaging 1.00
R4810_Plekha7_997 UTSW 7 115,744,173 (GRCm39) missense probably damaging 1.00
Rhexis UTSW 7 115,736,403 (GRCm39) splice site probably null
R0066:Plekha7 UTSW 7 115,756,743 (GRCm39) missense probably damaging 1.00
R0066:Plekha7 UTSW 7 115,756,743 (GRCm39) missense probably damaging 1.00
R0130:Plekha7 UTSW 7 115,769,939 (GRCm39) missense probably damaging 0.99
R0348:Plekha7 UTSW 7 115,757,255 (GRCm39) missense probably damaging 1.00
R0595:Plekha7 UTSW 7 115,744,203 (GRCm39) missense probably damaging 1.00
R0614:Plekha7 UTSW 7 115,753,880 (GRCm39) nonsense probably null
R0732:Plekha7 UTSW 7 115,744,472 (GRCm39) missense probably damaging 1.00
R1664:Plekha7 UTSW 7 115,734,269 (GRCm39) splice site probably null
R1695:Plekha7 UTSW 7 115,727,920 (GRCm39) missense probably damaging 1.00
R1794:Plekha7 UTSW 7 115,739,916 (GRCm39) missense probably damaging 1.00
R1895:Plekha7 UTSW 7 115,744,209 (GRCm39) missense probably damaging 1.00
R2153:Plekha7 UTSW 7 115,775,002 (GRCm39) missense probably damaging 1.00
R3605:Plekha7 UTSW 7 115,763,477 (GRCm39) missense possibly damaging 0.68
R3606:Plekha7 UTSW 7 115,763,477 (GRCm39) missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 115,774,969 (GRCm39) missense probably damaging 1.00
R4584:Plekha7 UTSW 7 115,836,768 (GRCm39) intron probably benign
R4750:Plekha7 UTSW 7 115,736,546 (GRCm39) missense probably damaging 1.00
R4774:Plekha7 UTSW 7 115,744,178 (GRCm39) missense probably damaging 1.00
R4810:Plekha7 UTSW 7 115,744,173 (GRCm39) missense probably damaging 1.00
R4895:Plekha7 UTSW 7 115,788,626 (GRCm39) splice site probably null
R4925:Plekha7 UTSW 7 115,757,363 (GRCm39) missense probably damaging 1.00
R5556:Plekha7 UTSW 7 115,763,384 (GRCm39) missense probably benign 0.20
R5599:Plekha7 UTSW 7 115,776,117 (GRCm39) splice site probably null
R5848:Plekha7 UTSW 7 115,739,634 (GRCm39) missense probably damaging 1.00
R5928:Plekha7 UTSW 7 115,727,809 (GRCm39) missense probably benign
R5941:Plekha7 UTSW 7 115,724,040 (GRCm39) missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 115,776,133 (GRCm39) missense probably damaging 1.00
R6520:Plekha7 UTSW 7 115,763,717 (GRCm39) missense probably benign 0.16
R6699:Plekha7 UTSW 7 115,734,410 (GRCm39) missense probably damaging 1.00
R6781:Plekha7 UTSW 7 115,757,090 (GRCm39) critical splice donor site probably null
R6843:Plekha7 UTSW 7 115,742,555 (GRCm39) missense probably benign 0.45
R6977:Plekha7 UTSW 7 115,735,202 (GRCm39) missense probably benign 0.01
R7048:Plekha7 UTSW 7 115,747,559 (GRCm39) missense probably benign 0.07
R7269:Plekha7 UTSW 7 115,780,447 (GRCm39) missense probably damaging 1.00
R7480:Plekha7 UTSW 7 115,736,403 (GRCm39) splice site probably null
R7520:Plekha7 UTSW 7 115,736,519 (GRCm39) missense possibly damaging 0.95
R7609:Plekha7 UTSW 7 115,763,681 (GRCm39) missense probably benign 0.25
R7680:Plekha7 UTSW 7 115,763,511 (GRCm39) missense probably benign 0.00
R7820:Plekha7 UTSW 7 115,836,715 (GRCm39) missense probably benign 0.12
R7989:Plekha7 UTSW 7 115,757,558 (GRCm39) missense probably benign 0.04
R8383:Plekha7 UTSW 7 115,744,154 (GRCm39) missense probably damaging 0.98
R8523:Plekha7 UTSW 7 115,907,164 (GRCm39) missense probably benign 0.01
R8863:Plekha7 UTSW 7 115,753,875 (GRCm39) missense probably damaging 1.00
R8920:Plekha7 UTSW 7 115,744,218 (GRCm39) missense probably benign 0.13
R8926:Plekha7 UTSW 7 115,756,223 (GRCm39) splice site probably benign
R9176:Plekha7 UTSW 7 115,739,926 (GRCm39) missense possibly damaging 0.94
R9576:Plekha7 UTSW 7 115,728,669 (GRCm39) missense possibly damaging 0.91
Z1177:Plekha7 UTSW 7 115,907,206 (GRCm39) missense probably damaging 1.00
Z1177:Plekha7 UTSW 7 115,739,898 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCCCAGGCCATAAGGTG -3'
(R):5'- CTTAAGCCAGGTTCCGACAG -3'

Sequencing Primer
(F):5'- ATAAGGTGGCACCCCGTTC -3'
(R):5'- CCAGGTTCCGACAGTAGGAG -3'
Posted On 2015-02-05