Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Grm1'

263066

Institutional Source

Beutler Lab

Gene Symbol

Grm1

Ensembl Gene

ENSMUSG00000019828

Gene Name

glutamate receptor, metabotropic 1

Synonyms

Grm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik

MMRRC Submission

040580-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.565) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10686059-11082356 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11079857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 228 (S228P)

Ref Sequence

ENSEMBL: ENSMUSP00000101190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]

AlphaFold

P97772

Predicted Effect

probably benign
Transcript: ENSMUST00000044306
AA Change: S228P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: S228P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	1.1e-94	PFAM
Pfam:Peripla_BP_6	151	340	1.4e-10	PFAM
Pfam:NCD3G	521	571	5.5e-16	PFAM
Pfam:7tm_3	604	837	2.4e-55	PFAM
low complexity region	969	975	N/A	INTRINSIC
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1013	1033	N/A	INTRINSIC
low complexity region	1071	1088	N/A	INTRINSIC
low complexity region	1093	1109	N/A	INTRINSIC
low complexity region	1126	1136	N/A	INTRINSIC
GluR_Homer-bdg	1149	1199	6.85e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105560
AA Change: S228P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: S228P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105561
AA Change: S228P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: S228P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156826

Meta Mutation Damage Score

0.9062

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Grm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01371:Grm1	APN	10	10720039	missense	probably benign	0.01
IGL02078:Grm1	APN	10	10689610	missense	probably benign	0.02
IGL02156:Grm1	APN	10	10719976	missense	probably damaging	0.99
IGL02476:Grm1	APN	10	10689453	missense	probably benign	0.29
IGL02498:Grm1	APN	10	10719979	missense	probably damaging	1.00
IGL02621:Grm1	APN	10	10689011	nonsense	probably null
IGL03192:Grm1	APN	10	11079916	missense	possibly damaging	0.66
IGL03342:Grm1	APN	10	11079971	missense	probably benign	0.08
dewey	UTSW	10	10719595	missense	probably damaging	1.00
Dingus	UTSW	10	10719967	missense	probably benign	0.06
donald	UTSW	10	10741508	nonsense	probably null
jim	UTSW	10	10719805	missense	probably damaging	1.00
lightness	UTSW	10	11079958	missense	probably damaging	1.00
IGL02796:Grm1	UTSW	10	10689667	missense	probably benign
R0294:Grm1	UTSW	10	11080399	missense	probably damaging	1.00
R0525:Grm1	UTSW	10	10719209	splice site	probably benign
R0554:Grm1	UTSW	10	10719923	missense	probably benign	0.01
R1184:Grm1	UTSW	10	10720034	missense	probably benign	0.40
R1319:Grm1	UTSW	10	10689398	missense	probably benign	0.05
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1494:Grm1	UTSW	10	10689706	missense	probably benign	0.04
R1589:Grm1	UTSW	10	10719967	missense	probably benign	0.06
R1615:Grm1	UTSW	10	10741508	nonsense	probably null
R1720:Grm1	UTSW	10	10746794	splice site	probably null
R1738:Grm1	UTSW	10	10936419	missense	probably damaging	1.00
R1763:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R1774:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R2041:Grm1	UTSW	10	10746603	missense	probably damaging	0.98
R2092:Grm1	UTSW	10	10689225	missense	probably benign	0.00
R2198:Grm1	UTSW	10	10782776	missense	probably damaging	1.00
R2297:Grm1	UTSW	10	11080414	missense	probably benign	0.03
R2333:Grm1	UTSW	10	10719346	missense	probably damaging	0.98
R2333:Grm1	UTSW	10	10719619	missense	probably benign	0.31
R2914:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3105:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3705:Grm1	UTSW	10	10782729	missense	possibly damaging	0.95
R3931:Grm1	UTSW	10	10719878	missense	probably benign	0.44
R4810:Grm1	UTSW	10	10782694	missense	probably damaging	1.00
R4892:Grm1	UTSW	10	10719587	missense	possibly damaging	0.81
R4938:Grm1	UTSW	10	10936513	missense	probably damaging	1.00
R4947:Grm1	UTSW	10	10782633	missense	probably damaging	1.00
R4966:Grm1	UTSW	10	10719665	nonsense	probably null
R5152:Grm1	UTSW	10	11079875	missense	probably benign	0.13
R5283:Grm1	UTSW	10	10733192	missense	possibly damaging	0.70
R5317:Grm1	UTSW	10	10746699	missense	possibly damaging	0.77
R5374:Grm1	UTSW	10	11080442	missense	probably benign	0.14
R5428:Grm1	UTSW	10	10719563	missense	probably damaging	1.00
R5604:Grm1	UTSW	10	10746735	missense	probably damaging	1.00
R5894:Grm1	UTSW	10	11080255	missense	probably damaging	1.00
R5896:Grm1	UTSW	10	11080550	utr 5 prime	probably benign
R5899:Grm1	UTSW	10	10689348	missense	probably benign
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6139:Grm1	UTSW	10	10746331	intron	probably benign
R6144:Grm1	UTSW	10	11079896	missense	probably benign	0.08
R6208:Grm1	UTSW	10	10719946	missense	probably damaging	1.00
R6976:Grm1	UTSW	10	10689180	missense	probably benign	0.00
R7027:Grm1	UTSW	10	10719595	missense	probably damaging	1.00
R7079:Grm1	UTSW	10	11079958	missense	probably damaging	1.00
R7286:Grm1	UTSW	10	10689696	missense	probably benign	0.19
R7352:Grm1	UTSW	10	10719493	missense	probably damaging	1.00
R7484:Grm1	UTSW	10	10746659	missense	probably benign	0.06
R7838:Grm1	UTSW	10	11080352	missense	probably benign	0.02
R8108:Grm1	UTSW	10	10720132	missense	probably benign	0.01
R8379:Grm1	UTSW	10	10689135	missense	possibly damaging	0.86
R8498:Grm1	UTSW	10	11079861	nonsense	probably null
R8712:Grm1	UTSW	10	10689552	missense	probably benign	0.34
R8856:Grm1	UTSW	10	10719348	missense	probably damaging	1.00
R8904:Grm1	UTSW	10	10719537	missense	probably damaging	1.00
R9043:Grm1	UTSW	10	10689312	nonsense	probably null
R9477:Grm1	UTSW	10	10719661	missense	probably benign	0.15
R9674:Grm1	UTSW	10	10733284	missense	possibly damaging	0.91
R9685:Grm1	UTSW	10	10689031	missense	possibly damaging	0.91
R9777:Grm1	UTSW	10	10698082	missense	possibly damaging	0.92
X0002:Grm1	UTSW	10	10936513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCCTGGAATGTGGTTTTACTG -3'
(R):5'- TGGCCATTCAAGTCCAGAATC -3'

Sequencing Primer
(F):5'- ACTGCACTGTAATTATCGGGG -3'
(R):5'- AGAATCTTCTGCAGCTGTTCGAC -3'

Posted On

2015-02-05