Incidental Mutation 'R3106:Adarb1'
ID 263067
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms 1700057H01Rik, RED1, D10Bwg0447e, ADAR2
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 77126560-77254104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 77157591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 285 (K285N)
Ref Sequence ENSEMBL: ENSMUSP00000101046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000020496
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098374
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105404
Predicted Effect probably damaging
Transcript: ENSMUST00000105406
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126073
Predicted Effect probably benign
Transcript: ENSMUST00000144547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155117
Meta Mutation Damage Score 0.8586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77,158,324 (GRCm39) missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77,158,051 (GRCm39) missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77,157,659 (GRCm39) missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77,158,135 (GRCm39) missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77,131,588 (GRCm39) missense probably benign 0.02
IGL02699:Adarb1 APN 10 77,157,853 (GRCm39) missense probably benign
IGL02867:Adarb1 APN 10 77,149,375 (GRCm39) missense probably benign 0.01
IGL02889:Adarb1 APN 10 77,149,375 (GRCm39) missense probably benign 0.01
IGL03133:Adarb1 APN 10 77,161,730 (GRCm39) start gained probably benign
R1806:Adarb1 UTSW 10 77,158,099 (GRCm39) missense probably damaging 0.98
R1834:Adarb1 UTSW 10 77,153,065 (GRCm39) splice site probably benign
R2174:Adarb1 UTSW 10 77,131,632 (GRCm39) missense probably benign 0.35
R2233:Adarb1 UTSW 10 77,153,183 (GRCm39) missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77,153,183 (GRCm39) missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77,149,237 (GRCm39) critical splice donor site probably null
R5104:Adarb1 UTSW 10 77,158,121 (GRCm39) missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77,161,679 (GRCm39) intron probably benign
R5497:Adarb1 UTSW 10 77,161,723 (GRCm39) missense probably damaging 0.96
R5869:Adarb1 UTSW 10 77,161,450 (GRCm39) intron probably benign
R6168:Adarb1 UTSW 10 77,158,153 (GRCm39) missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77,131,712 (GRCm39) critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77,139,129 (GRCm39) missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77,131,542 (GRCm39) missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77,157,626 (GRCm39) missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77,157,626 (GRCm39) missense probably damaging 1.00
R9350:Adarb1 UTSW 10 77,158,267 (GRCm39) missense possibly damaging 0.91
R9457:Adarb1 UTSW 10 77,157,982 (GRCm39) missense possibly damaging 0.46
R9688:Adarb1 UTSW 10 77,147,099 (GRCm39) missense probably damaging 1.00
R9716:Adarb1 UTSW 10 77,131,539 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCTGCTTAGAAATGTTATCAAGGG -3'
(R):5'- AAGTGGAGATGTCAGCCTATCG -3'

Sequencing Primer
(F):5'- ATGTTATCAAGGGCAGTGGC -3'
(R):5'- AGTGCCTGCCAGCCTTAC -3'
Posted On 2015-02-05