Incidental Mutation 'R3106:Adarb1'
ID 263067
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms RED1, D10Bwg0447e, ADAR2, 1700057H01Rik
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 77290726-77418270 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 77321757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 285 (K285N)
Ref Sequence ENSEMBL: ENSMUSP00000101046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000020496
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098374
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105404
Predicted Effect probably damaging
Transcript: ENSMUST00000105406
AA Change: K285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262
AA Change: K285N

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126073
Predicted Effect probably benign
Transcript: ENSMUST00000144547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156583
Meta Mutation Damage Score 0.8586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77322490 missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77322217 missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77321825 missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77322301 missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77295754 missense probably benign 0.02
IGL02699:Adarb1 APN 10 77322019 missense probably benign
IGL02867:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL02889:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL03133:Adarb1 APN 10 77325896 start gained probably benign
R1806:Adarb1 UTSW 10 77322265 missense probably damaging 0.98
R1834:Adarb1 UTSW 10 77317231 splice site probably benign
R2174:Adarb1 UTSW 10 77295798 missense probably benign 0.35
R2233:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77313403 critical splice donor site probably null
R5104:Adarb1 UTSW 10 77322287 missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77325845 intron probably benign
R5497:Adarb1 UTSW 10 77325889 missense probably damaging 0.96
R5869:Adarb1 UTSW 10 77325616 intron probably benign
R6168:Adarb1 UTSW 10 77322319 missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77295878 critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77303295 missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77295708 missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9350:Adarb1 UTSW 10 77322433 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTGCTTAGAAATGTTATCAAGGG -3'
(R):5'- AAGTGGAGATGTCAGCCTATCG -3'

Sequencing Primer
(F):5'- ATGTTATCAAGGGCAGTGGC -3'
(R):5'- AGTGCCTGCCAGCCTTAC -3'
Posted On 2015-02-05