Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Sppl2b'

263068

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

040580-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80867491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 529 (E529G)

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000219817] [ENSMUST00000220091]

AlphaFold

Q3TD49

Predicted Effect

probably benign
Transcript: ENSMUST00000035597
AA Change: E529G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: E529G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217714

Predicted Effect

probably benign
Transcript: ENSMUST00000218789

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219366

Predicted Effect

probably benign
Transcript: ENSMUST00000219614

Predicted Effect

probably benign
Transcript: ENSMUST00000219817

Predicted Effect

probably benign
Transcript: ENSMUST00000219951

Predicted Effect

probably benign
Transcript: ENSMUST00000220091

Meta Mutation Damage Score

0.1628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8212:Sppl2b	UTSW	10	80865359	missense	probably damaging	1.00
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8367:Sppl2b	UTSW	10	80863191	missense	probably benign	0.02
R8398:Sppl2b	UTSW	10	80866068	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8480:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9175:Sppl2b	UTSW	10	80862973	missense	probably benign
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GAATGCCTCCTGCTCTAAGTGTC -3'
(R):5'- AGGCCTGAGCACCATGTTAG -3'

Sequencing Primer
(F):5'- CCTGCACCTGTGTGGGTTC -3'
(R):5'- CCAGGTGGTCAGCATCTGTG -3'

Posted On

2015-02-05