Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Galnt4'

263069

Institutional Source

Beutler Lab

Gene Symbol

Galnt4

Ensembl Gene

ENSMUSG00000090035

Gene Name

polypeptide N-acetylgalactosaminyltransferase 4

Synonyms

ppGaNTase-T4

MMRRC Submission

040580-MU

Accession Numbers

Genbank: NM_015737; MGI: 894692

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99108159-99113247 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99109381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 323 (Y323H)

Ref Sequence

ENSEMBL: ENSMUSP00000125315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]

AlphaFold

O08832

Predicted Effect

probably benign
Transcript: ENSMUST00000020113

SMART Domains

Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

Domain	Start	End	E-Value	Type
WD40	7	46	1.71e-7	SMART
WD40	49	88	8.68e-9	SMART
WD40	91	130	2.71e-10	SMART
WD40	133	172	2.43e-12	SMART
WD40	175	214	2.07e-6	SMART
WD40	217	256	1.71e-7	SMART
WD40	259	298	7.55e-9	SMART
coiled coil region	428	468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159228

SMART Domains

Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

Domain	Start	End	E-Value	Type
WD40	7	46	1.71e-7	SMART
WD40	49	88	8.68e-9	SMART
WD40	91	130	2.71e-10	SMART
WD40	133	172	2.43e-12	SMART
WD40	175	214	2.07e-6	SMART
WD40	217	256	1.71e-7	SMART
WD40	259	298	7.55e-9	SMART
coiled coil region	401	441	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159990

SMART Domains

Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

Domain	Start	End	E-Value	Type
WD40	7	46	8.68e-9	SMART
WD40	49	88	2.71e-10	SMART
WD40	91	130	2.43e-12	SMART
WD40	133	172	2.07e-6	SMART
WD40	175	214	1.71e-7	SMART
WD40	217	256	7.55e-9	SMART
coiled coil region	386	426	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161240
AA Change: Y323H

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035
AA Change: Y323H

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	135	382	4.7e-10	PFAM
Pfam:Glycos_transf_2	138	321	7.5e-38	PFAM
Pfam:Glyco_tranf_2_2	138	368	1e-7	PFAM
Pfam:Glyco_transf_7C	298	367	4.5e-10	PFAM
low complexity region	411	420	N/A	INTRINSIC
RICIN	445	577	2.39e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218379

Predicted Effect

probably benign
Transcript: ENSMUST00000219884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220019

Meta Mutation Damage Score

0.0649

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Il1rap	A	G	16: 26,722,752	E581G	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Galnt4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Galnt4	APN	10	99109597	missense	probably damaging	1.00
IGL01725:Galnt4	APN	10	99109957	missense	probably damaging	1.00
IGL01871:Galnt4	APN	10	99109241	missense	probably damaging	1.00
IGL02146:Galnt4	APN	10	99109701	missense	possibly damaging	0.87
3-1:Galnt4	UTSW	10	99109265	missense	probably damaging	1.00
R0041:Galnt4	UTSW	10	99108512	missense	probably benign	0.08
R1318:Galnt4	UTSW	10	99109910	missense	probably damaging	0.99
R1466:Galnt4	UTSW	10	99108709	missense	probably benign	0.43
R1466:Galnt4	UTSW	10	99108709	missense	probably benign	0.43
R1471:Galnt4	UTSW	10	99108674	missense	probably benign
R1633:Galnt4	UTSW	10	99109952	missense	possibly damaging	0.88
R2088:Galnt4	UTSW	10	99109184	missense	probably damaging	1.00
R2197:Galnt4	UTSW	10	99108647	missense	probably damaging	1.00
R2363:Galnt4	UTSW	10	99109061	missense	probably damaging	1.00
R2507:Galnt4	UTSW	10	99109286	missense	possibly damaging	0.78
R3104:Galnt4	UTSW	10	99109381	missense	probably benign	0.10
R4599:Galnt4	UTSW	10	99109493	missense	probably damaging	1.00
R4670:Galnt4	UTSW	10	99109298	missense	possibly damaging	0.60
R4756:Galnt4	UTSW	10	99108500	missense	probably benign
R5660:Galnt4	UTSW	10	99109535	missense	probably benign	0.16
R5819:Galnt4	UTSW	10	99110030	missense	probably damaging	1.00
R6441:Galnt4	UTSW	10	99110098	missense	possibly damaging	0.95
R7184:Galnt4	UTSW	10	99108604	missense	probably damaging	1.00
R7429:Galnt4	UTSW	10	99109748	missense	probably damaging	1.00
R7685:Galnt4	UTSW	10	99109964	missense	probably benign	0.00
R7788:Galnt4	UTSW	10	99109113	missense	possibly damaging	0.93
R8192:Galnt4	UTSW	10	99109256	missense	probably benign	0.29
R8896:Galnt4	UTSW	10	99110093	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAATTCTACATGCAGACCGGGG -3'
(R):5'- ATAGGCCTCTTTCCGAGCTG -3'

Sequencing Primer
(F):5'- ACCGGGGAGCCCATGATTG -3'
(R):5'- ATCCACACTTCGGCCGC -3'

Posted On

2015-02-05