Incidental Mutation 'R3106:Btf3'
ID 263074
Institutional Source Beutler Lab
Gene Symbol Btf3
Ensembl Gene ENSMUSG00000021660
Gene Name basic transcription factor 3
Synonyms 1700054E11Rik
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 98446405-98453514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 98447496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 145 (E145D)
Ref Sequence ENSEMBL: ENSMUSP00000118093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022163] [ENSMUST00000134542] [ENSMUST00000152704] [ENSMUST00000180066] [ENSMUST00000186911] [ENSMUST00000180188]
AlphaFold Q64152
Predicted Effect probably benign
Transcript: ENSMUST00000022163
AA Change: E187D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022163
Gene: ENSMUSG00000021660
AA Change: E187D

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Pfam:NAC 83 139 6.2e-30 PFAM
low complexity region 182 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133826
Predicted Effect probably benign
Transcript: ENSMUST00000134542
AA Change: E145D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115500
Gene: ENSMUSG00000021660
AA Change: E145D

DomainStartEndE-ValueType
Pfam:NAC 41 98 1.9e-26 PFAM
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152704
AA Change: E145D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118093
Gene: ENSMUSG00000021660
AA Change: E145D

DomainStartEndE-ValueType
Pfam:NAC 41 98 1.9e-26 PFAM
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180066
Predicted Effect probably benign
Transcript: ENSMUST00000186911
SMART Domains Protein: ENSMUSP00000139945
Gene: ENSMUSG00000096330

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LDLa 52 91 1.4e-9 SMART
LDLa 98 136 3.4e-4 SMART
LDLa 141 175 9.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180188
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertional mutation results in homozygous embryonic lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sfmbt1 G A 14: 30,539,753 (GRCm39) C847Y probably damaging Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Btf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02613:Btf3 APN 13 98,446,714 (GRCm39) unclassified probably benign
R1726:Btf3 UTSW 13 98,452,804 (GRCm39) start codon destroyed probably null 0.01
R1740:Btf3 UTSW 13 98,452,804 (GRCm39) start codon destroyed probably null 0.01
R1741:Btf3 UTSW 13 98,452,804 (GRCm39) start codon destroyed probably null 0.01
R1742:Btf3 UTSW 13 98,452,804 (GRCm39) start codon destroyed probably null 0.01
R2096:Btf3 UTSW 13 98,449,659 (GRCm39) missense possibly damaging 0.94
R4571:Btf3 UTSW 13 98,449,792 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTATCATGACATGATCTGAGC -3'
(R):5'- GCTGGTGCTATAGGTGAGAC -3'

Sequencing Primer
(F):5'- GGTCTCAAATCTAAGGCAGGCC -3'
(R):5'- GTGAGACCTCAGATGTCACTTGAC -3'
Posted On 2015-02-05