Incidental Mutation 'R3106:Sfmbt1'
ID 263075
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene Name Scm-like with four mbt domains 1
Synonyms Smr, 4930442N21Rik, 9330180L21Rik
MMRRC Submission 040580-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.679) question?
Stock # R3106 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 30436806-30544678 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30539753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 847 (C847Y)
Ref Sequence ENSEMBL: ENSMUSP00000153861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
AlphaFold Q9JMD1
Predicted Effect probably damaging
Transcript: ENSMUST00000054230
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112177
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107799
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112184
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000227201
Predicted Effect probably damaging
Transcript: ENSMUST00000227303
AA Change: C804Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228006
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,995,856 (GRCm39) E1331V possibly damaging Het
Adam22 A G 5: 8,167,583 (GRCm39) probably null Het
Adamts17 T A 7: 66,774,820 (GRCm39) S980T probably damaging Het
Adarb1 C A 10: 77,157,591 (GRCm39) K285N probably damaging Het
Atp5f1c A G 2: 10,068,276 (GRCm39) S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Btf3 T G 13: 98,447,496 (GRCm39) E145D probably benign Het
Ccdc184 G T 15: 98,066,482 (GRCm39) A96S probably damaging Het
Ccdc191 T C 16: 43,751,573 (GRCm39) F301S probably damaging Het
Ceacam5 T C 7: 17,481,248 (GRCm39) Y332H probably benign Het
Clip2 T C 5: 134,551,918 (GRCm39) K68R probably benign Het
Cntln C T 4: 84,875,406 (GRCm39) T280M possibly damaging Het
Col6a3 T C 1: 90,744,024 (GRCm39) R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 (GRCm39) L662F probably benign Het
Dennd3 C A 15: 73,436,973 (GRCm39) S118* probably null Het
Dgkg T A 16: 22,394,091 (GRCm39) T321S probably damaging Het
Dzip1l A T 9: 99,524,625 (GRCm39) K249* probably null Het
Dzip1l A G 9: 99,529,174 (GRCm39) E301G probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Ezh1 A C 11: 101,086,468 (GRCm39) C575W probably damaging Het
Fam187b A G 7: 30,676,665 (GRCm39) D58G probably benign Het
Galnt4 T C 10: 98,945,243 (GRCm39) Y323H probably benign Het
Grm1 A G 10: 10,955,601 (GRCm39) S228P probably benign Het
H1f2 G T 13: 23,922,883 (GRCm39) A18S unknown Het
Hnf4g T G 3: 3,717,916 (GRCm39) S388R probably benign Het
Il1rap A G 16: 26,541,502 (GRCm39) E581G probably benign Het
Lemd2 C A 17: 27,420,644 (GRCm39) L256F probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Nphs1 C A 7: 30,166,965 (GRCm39) S724* probably null Het
Or4g17 A G 2: 111,209,840 (GRCm39) N165S probably benign Het
Or5w13 T C 2: 87,523,849 (GRCm39) I126V probably damaging Het
Osgep T C 14: 51,154,286 (GRCm39) T225A probably benign Het
Pan3 T C 5: 147,476,189 (GRCm39) probably benign Het
Pld3 A G 7: 27,235,212 (GRCm39) probably null Het
Plekha7 C T 7: 115,763,639 (GRCm39) R321K probably benign Het
Plekhg5 C T 4: 152,196,635 (GRCm39) T694M probably damaging Het
Pramel31 T C 4: 144,088,246 (GRCm39) V14A probably benign Het
Ptpn20 A G 14: 33,334,253 (GRCm39) I44V probably benign Het
Ptprj T A 2: 90,270,975 (GRCm39) H1251L probably damaging Het
Sbspon T C 1: 15,962,806 (GRCm39) E24G probably benign Het
Sparcl1 T C 5: 104,241,203 (GRCm39) T74A probably benign Het
Sppl2b A G 10: 80,703,325 (GRCm39) E529G probably benign Het
Stradb C A 1: 59,031,450 (GRCm39) H212Q possibly damaging Het
Tkfc G T 19: 10,574,357 (GRCm39) C198* probably null Het
Tm4sf4 C T 3: 57,345,043 (GRCm39) R150C possibly damaging Het
Tmem212 T C 3: 27,939,019 (GRCm39) S156G probably damaging Het
Tmem51 T C 4: 141,765,035 (GRCm39) N8D probably damaging Het
Tmigd1 A G 11: 76,801,124 (GRCm39) T204A possibly damaging Het
Trp53bp1 A G 2: 121,067,133 (GRCm39) L531S probably damaging Het
Tsga10 G A 1: 37,840,872 (GRCm39) L445F probably damaging Het
Urb1 C T 16: 90,592,331 (GRCm39) V310I probably damaging Het
Vmn2r129 T A 4: 156,685,730 (GRCm39) noncoding transcript Het
Wdr19 T C 5: 65,359,966 (GRCm39) S24P probably benign Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30,532,268 (GRCm39) missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30,491,777 (GRCm39) missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30,533,478 (GRCm39) missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30,539,669 (GRCm39) missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30,539,690 (GRCm39) missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30,507,837 (GRCm39) missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30,537,494 (GRCm39) missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30,538,759 (GRCm39) missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30,538,714 (GRCm39) splice site probably null
PIT4519001:Sfmbt1 UTSW 14 30,506,148 (GRCm39) critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30,518,283 (GRCm39) missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30,538,764 (GRCm39) missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30,533,464 (GRCm39) missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30,509,574 (GRCm39) splice site probably benign
R0562:Sfmbt1 UTSW 14 30,533,330 (GRCm39) splice site probably null
R1083:Sfmbt1 UTSW 14 30,509,498 (GRCm39) missense possibly damaging 0.92
R1900:Sfmbt1 UTSW 14 30,524,524 (GRCm39) missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30,495,850 (GRCm39) missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30,539,753 (GRCm39) missense probably damaging 1.00
R3105:Sfmbt1 UTSW 14 30,539,753 (GRCm39) missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30,509,449 (GRCm39) missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30,512,727 (GRCm39) missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30,537,211 (GRCm39) critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30,538,777 (GRCm39) missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30,538,777 (GRCm39) missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30,495,986 (GRCm39) missense probably damaging 1.00
R5620:Sfmbt1 UTSW 14 30,506,148 (GRCm39) critical splice donor site probably null
R6113:Sfmbt1 UTSW 14 30,537,141 (GRCm39) missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30,533,375 (GRCm39) missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30,495,868 (GRCm39) missense probably damaging 1.00
R6657:Sfmbt1 UTSW 14 30,488,053 (GRCm39) missense possibly damaging 0.50
R6955:Sfmbt1 UTSW 14 30,487,991 (GRCm39) start gained probably benign
R6957:Sfmbt1 UTSW 14 30,509,546 (GRCm39) missense probably benign 0.00
R7206:Sfmbt1 UTSW 14 30,533,330 (GRCm39) splice site probably null
R7337:Sfmbt1 UTSW 14 30,506,696 (GRCm39) missense possibly damaging 0.62
R7451:Sfmbt1 UTSW 14 30,538,768 (GRCm39) missense probably benign 0.02
R7684:Sfmbt1 UTSW 14 30,532,311 (GRCm39) missense probably damaging 1.00
R7798:Sfmbt1 UTSW 14 30,538,759 (GRCm39) missense probably damaging 1.00
R7983:Sfmbt1 UTSW 14 30,519,673 (GRCm39) splice site probably null
R8468:Sfmbt1 UTSW 14 30,495,941 (GRCm39) missense probably benign
R9342:Sfmbt1 UTSW 14 30,519,599 (GRCm39) missense possibly damaging 0.94
R9446:Sfmbt1 UTSW 14 30,506,697 (GRCm39) missense possibly damaging 0.95
R9590:Sfmbt1 UTSW 14 30,512,727 (GRCm39) missense probably damaging 1.00
R9674:Sfmbt1 UTSW 14 30,495,851 (GRCm39) missense probably damaging 0.98
X0064:Sfmbt1 UTSW 14 30,537,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTAGCAGACTATGGTTC -3'
(R):5'- GTGCAAAGATAGCAAGCCAC -3'

Sequencing Primer
(F):5'- AGCAGACTATGGTTCTTTTCAAAGGG -3'
(R):5'- ACCACTTGCAGGCCGACAG -3'
Posted On 2015-02-05