Mutagenetix > Incidental Mutation

Incidental Mutation 'R3106:Il1rap'

263081

Institutional Source

Beutler Lab

Gene Symbol

Il1rap

Ensembl Gene

ENSMUSG00000022514

Gene Name

interleukin 1 receptor accessory protein

Synonyms

IL-1RAcP, 6430709H04Rik, IL-1R AcP

MMRRC Submission

040580-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26581704-26730117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26722752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 581 (E581G)

Ref Sequence

ENSEMBL: ENSMUSP00000093843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096129] [ENSMUST00000166294]

AlphaFold

Q61730

Predicted Effect

probably benign
Transcript: ENSMUST00000096129
AA Change: E581G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: E581G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
IG	251	350	1.46e-5	SMART
low complexity region	368	381	N/A	INTRINSIC
TIR	404	547	1.38e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166294
AA Change: E581G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: E581G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
IG	251	350	1.46e-5	SMART
low complexity region	368	381	N/A	INTRINSIC
TIR	404	547	1.38e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172522

Predicted Effect

unknown
Transcript: ENSMUST00000173136
AA Change: E106G

SMART Domains

Protein: ENSMUSP00000133294
Gene: ENSMUSG00000022514
AA Change: E106G

Domain	Start	End	E-Value	Type
Blast:TIR	2	154	3e-48	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174644

Meta Mutation Damage Score

0.0589

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,396,633	E1331V	possibly damaging	Het
Adam22	A	G	5: 8,117,583		probably null	Het
Adamts17	T	A	7: 67,125,072	S980T	probably damaging	Het
Adarb1	C	A	10: 77,321,757	K285N	probably damaging	Het
Atp5c1	A	G	2: 10,063,465	S160P	probably benign	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Btf3	T	G	13: 98,310,988	E145D	probably benign	Het
Ccdc184	G	T	15: 98,168,601	A96S	probably damaging	Het
Ccdc191	T	C	16: 43,931,210	F301S	probably damaging	Het
Ceacam5	T	C	7: 17,747,323	Y332H	probably benign	Het
Clip2	T	C	5: 134,523,064	K68R	probably benign	Het
Cntln	C	T	4: 84,957,169	T280M	possibly damaging	Het
Col6a3	T	C	1: 90,816,302	R515G	probably damaging	Het
Ctnnal1	G	A	4: 56,813,246	L662F	probably benign	Het
Dennd3	C	A	15: 73,565,124	S118*	probably null	Het
Dgkg	T	A	16: 22,575,341	T321S	probably damaging	Het
Dzip1l	A	T	9: 99,642,572	K249*	probably null	Het
Dzip1l	A	G	9: 99,647,121	E301G	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Ezh1	A	C	11: 101,195,642	C575W	probably damaging	Het
Fam187b	A	G	7: 30,977,240	D58G	probably benign	Het
Galnt4	T	C	10: 99,109,381	Y323H	probably benign	Het
Gm13119	T	C	4: 144,361,676	V14A	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Hist1h1c	G	T	13: 23,738,900	A18S	unknown	Het
Hnf4g	T	G	3: 3,652,856	S388R	probably benign	Het
Lemd2	C	A	17: 27,201,670	L256F	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Nphs1	C	A	7: 30,467,540	S724*	probably null	Het
Olfr1136	T	C	2: 87,693,505	I126V	probably damaging	Het
Olfr1284	A	G	2: 111,379,495	N165S	probably benign	Het
Osgep	T	C	14: 50,916,829	T225A	probably benign	Het
Pan3	T	C	5: 147,539,379		probably benign	Het
Pld3	A	G	7: 27,535,787		probably null	Het
Plekha7	C	T	7: 116,164,404	R321K	probably benign	Het
Plekhg5	C	T	4: 152,112,178	T694M	probably damaging	Het
Ptpn20	A	G	14: 33,612,296	I44V	probably benign	Het
Ptprj	T	A	2: 90,440,631	H1251L	probably damaging	Het
Sbspon	T	C	1: 15,892,582	E24G	probably benign	Het
Sfmbt1	G	A	14: 30,817,796	C847Y	probably damaging	Het
Sparcl1	T	C	5: 104,093,337	T74A	probably benign	Het
Sppl2b	A	G	10: 80,867,491	E529G	probably benign	Het
Stradb	C	A	1: 58,992,291	H212Q	possibly damaging	Het
Tkfc	G	T	19: 10,596,993	C198*	probably null	Het
Tm4sf4	C	T	3: 57,437,622	R150C	possibly damaging	Het
Tmem212	T	C	3: 27,884,870	S156G	probably damaging	Het
Tmem51	T	C	4: 142,037,724	N8D	probably damaging	Het
Tmigd1	A	G	11: 76,910,298	T204A	possibly damaging	Het
Trp53bp1	A	G	2: 121,236,652	L531S	probably damaging	Het
Tsga10	G	A	1: 37,801,791	L445F	probably damaging	Het
Urb1	C	T	16: 90,795,443	V310I	probably damaging	Het
Vmn2r-ps159	T	A	4: 156,333,435		noncoding transcript	Het
Wdr19	T	C	5: 65,202,623	S24P	probably benign	Het

Other mutations in Il1rap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Il1rap	APN	16	26722401	missense	possibly damaging	0.77
IGL00976:Il1rap	APN	16	26698839	missense	probably benign	0.09
IGL01075:Il1rap	APN	16	26680237	missense	possibly damaging	0.94
IGL01665:Il1rap	APN	16	26722713	missense	probably damaging	1.00
IGL01962:Il1rap	APN	16	26710568	nonsense	probably null
IGL02101:Il1rap	APN	16	26624182	missense	possibly damaging	0.61
IGL02411:Il1rap	APN	16	26710616	missense	probably damaging	1.00
IGL03132:Il1rap	APN	16	26680119	missense	probably damaging	1.00
bacchus	UTSW	16	26710632	critical splice donor site	probably null
I1329:Il1rap	UTSW	16	26692850	missense	probably benign	0.07
LCD18:Il1rap	UTSW	16	26631593	intron	probably benign
PIT1430001:Il1rap	UTSW	16	26710593	missense	possibly damaging	0.53
R0302:Il1rap	UTSW	16	26692794	missense	probably benign	0.02
R0454:Il1rap	UTSW	16	26698875	missense	probably damaging	1.00
R0481:Il1rap	UTSW	16	26692835	missense	probably damaging	1.00
R0612:Il1rap	UTSW	16	26701105	missense	possibly damaging	0.48
R0765:Il1rap	UTSW	16	26710632	critical splice donor site	probably null
R1552:Il1rap	UTSW	16	26722434	missense	possibly damaging	0.79
R1801:Il1rap	UTSW	16	26698875	missense	probably damaging	1.00
R1867:Il1rap	UTSW	16	26722926	missense	probably damaging	1.00
R1942:Il1rap	UTSW	16	26722455	missense	probably damaging	1.00
R1996:Il1rap	UTSW	16	26722493	missense	probably benign	0.06
R2118:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R2122:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R2124:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R3104:Il1rap	UTSW	16	26722752	missense	probably benign	0.01
R3105:Il1rap	UTSW	16	26722752	missense	probably benign	0.01
R3891:Il1rap	UTSW	16	26676856	missense	probably damaging	1.00
R4133:Il1rap	UTSW	16	26722886	missense	probably benign	0.34
R4409:Il1rap	UTSW	16	26712265	splice site	probably null
R4610:Il1rap	UTSW	16	26714776	missense	probably benign	0.11
R4755:Il1rap	UTSW	16	26722782	missense	probably benign	0.20
R4776:Il1rap	UTSW	16	26692799	missense	possibly damaging	0.57
R4793:Il1rap	UTSW	16	26695234	missense	probably benign	0.09
R4811:Il1rap	UTSW	16	26701238	critical splice donor site	probably null
R4834:Il1rap	UTSW	16	26676935	missense	probably damaging	1.00
R5119:Il1rap	UTSW	16	26624199	missense	probably benign	0.01
R5744:Il1rap	UTSW	16	26680224	missense	probably benign	0.01
R6108:Il1rap	UTSW	16	26722707	missense	probably damaging	1.00
R6149:Il1rap	UTSW	16	26712219	missense	probably damaging	1.00
R6233:Il1rap	UTSW	16	26710506	missense	probably benign	0.24
R6246:Il1rap	UTSW	16	26714881	missense	probably benign
R6249:Il1rap	UTSW	16	26692848	missense	possibly damaging	0.88
R6254:Il1rap	UTSW	16	26695270	missense	probably benign
R6748:Il1rap	UTSW	16	26722356	missense	probably benign	0.02
R7151:Il1rap	UTSW	16	26712128	missense	probably damaging	1.00
R7794:Il1rap	UTSW	16	26722908	missense	probably benign
R7818:Il1rap	UTSW	16	26698847	missense	probably damaging	1.00
R7819:Il1rap	UTSW	16	26722401	missense	possibly damaging	0.77
R7863:Il1rap	UTSW	16	26676711	missense	probably damaging	1.00
R8240:Il1rap	UTSW	16	26701251	missense	probably benign
R8559:Il1rap	UTSW	16	26712134	missense	probably benign	0.29
R8934:Il1rap	UTSW	16	26676984	missense	probably damaging	1.00
R8986:Il1rap	UTSW	16	26714946	missense	probably damaging	1.00
R9261:Il1rap	UTSW	16	26722974	missense	possibly damaging	0.83
R9286:Il1rap	UTSW	16	26698854	missense	possibly damaging	0.89
R9326:Il1rap	UTSW	16	26676891	missense	probably damaging	1.00
R9408:Il1rap	UTSW	16	26714925	missense	possibly damaging	0.91
R9493:Il1rap	UTSW	16	26722952	missense	probably benign	0.00
R9723:Il1rap	UTSW	16	26624157	start codon destroyed	probably null	0.97
X0027:Il1rap	UTSW	16	26701147	missense	probably benign	0.20
X0028:Il1rap	UTSW	16	26676964	missense	probably damaging	1.00
Z1176:Il1rap	UTSW	16	26722399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCAGCTGAAGGAGTCTGTG -3'
(R):5'- TCTTGGAGAGGAGGCTTACAG -3'

Sequencing Primer
(F):5'- AAGGAGTCTGTGTCTTTTGTAAGC -3'
(R):5'- ACAGAGGTGTGTTTCCCAC -3'

Posted On

2015-02-05