Incidental Mutation 'R3106:Lemd2'
ID263085
Institutional Source Beutler Lab
Gene Symbol Lemd2
Ensembl Gene ENSMUSG00000044857
Gene NameLEM domain containing 2
SynonymsNET25, Lem2
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3106 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27189601-27204438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27201670 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 256 (L256F)
Ref Sequence ENSEMBL: ENSMUSP00000058221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055117]
Predicted Effect probably damaging
Transcript: ENSMUST00000055117
AA Change: L256F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058221
Gene: ENSMUSG00000044857
AA Change: L256F

DomainStartEndE-ValueType
LEM 1 42 2.19e-16 SMART
low complexity region 65 86 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
transmembrane domain 221 239 N/A INTRINSIC
Pfam:MSC 251 503 7.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180434
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LEM domain-containing transmembrane protein of the inner nuclear membrane. The protein is involved in nuclear structure organization and plays a role in cell signaling and differentiation. Mutations in this gene result in Cataract 46, juvenile-onset. Multiple transcript variants have been found for this gene. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygotes for a gene-trapped allele die by E11.5 exhibiting reduced embryo size and cell density in neural tissue and mesenchyme, underdeveloped cardiac and neural tissue, and hyperactivation of MAPK and AKT signaling. Heterozygotes show a modest delayin cardiotoxin-induced muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Lemd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Lemd2 APN 17 27190728 missense probably damaging 1.00
IGL02161:Lemd2 APN 17 27190651 missense probably damaging 1.00
IGL02903:Lemd2 APN 17 27193210 splice site probably benign
R0078:Lemd2 UTSW 17 27203728 missense probably benign 0.17
R0458:Lemd2 UTSW 17 27190653 missense probably damaging 0.99
R1396:Lemd2 UTSW 17 27190732 missense probably damaging 1.00
R4319:Lemd2 UTSW 17 27201677 missense possibly damaging 0.87
R4930:Lemd2 UTSW 17 27193832 splice site probably null
R5172:Lemd2 UTSW 17 27195382 nonsense probably null
R5239:Lemd2 UTSW 17 27203799 missense possibly damaging 0.53
R6005:Lemd2 UTSW 17 27190785 missense probably damaging 1.00
R6196:Lemd2 UTSW 17 27193002 nonsense probably null
R6621:Lemd2 UTSW 17 27195392 missense probably benign 0.01
R7208:Lemd2 UTSW 17 27196191 missense probably damaging 1.00
R7552:Lemd2 UTSW 17 27193836 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACATCGTCACAGAACATGATGTG -3'
(R):5'- TGTACAGCTGGAAAGAGGCC -3'

Sequencing Primer
(F):5'- CAGAACATGATGTGATTCCGGTAC -3'
(R):5'- TGGAAAGAGGCCCCAGCTAC -3'
Posted On2015-02-05