Incidental Mutation 'R3117:Olfr855'
ID263095
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Nameolfactory receptor 855
SynonymsMOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R3117 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19582617-19586030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19584941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 135 (I135F)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
Predicted Effect probably damaging
Transcript: ENSMUST00000061693
AA Change: I135F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: I135F

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215587
AA Change: I135F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Fcho2 A C 13: 98,777,438 I217S probably damaging Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hacd3 G T 9: 64,998,309 D182E probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mlc1 T C 15: 88,976,528 D93G probably damaging Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GACATTGGTTTAAGCACAGCC -3'
(R):5'- TTGCAACAAAGAGCACGATG -3'

Sequencing Primer
(F):5'- TTGGTTTAAGCACAGCCACAGTC -3'
(R):5'- AGAGCACGATGTTGTCAATTCG -3'
Posted On2015-02-05