Incidental Mutation 'R3117:Hacd3'
ID263097
Institutional Source Beutler Lab
Gene Symbol Hacd3
Ensembl Gene ENSMUSG00000033629
Gene Name3-hydroxyacyl-CoA dehydratase 3
SynonymsB-ind1, Hspc121, Ptplad1
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3117 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64986983-65021693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64998309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 182 (D182E)
Ref Sequence ENSEMBL: ENSMUSP00000044955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036615]
Predicted Effect probably damaging
Transcript: ENSMUST00000036615
AA Change: D182E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044955
Gene: ENSMUSG00000033629
AA Change: D182E

DomainStartEndE-ValueType
Pfam:CS 8 84 2.3e-7 PFAM
low complexity region 119 136 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
Pfam:PTPLA 195 356 1.5e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Fcho2 A C 13: 98,777,438 I217S probably damaging Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mlc1 T C 15: 88,976,528 D93G probably damaging Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Olfr855 A T 9: 19,584,941 I135F probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Hacd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Hacd3 APN 9 65004253 splice site probably benign
IGL01323:Hacd3 APN 9 64998305 missense probably damaging 1.00
IGL02943:Hacd3 APN 9 64990436 missense probably damaging 0.99
R0145:Hacd3 UTSW 9 65004242 splice site probably benign
R0390:Hacd3 UTSW 9 65001022 missense possibly damaging 0.89
R2403:Hacd3 UTSW 9 65001029 missense probably damaging 1.00
R3740:Hacd3 UTSW 9 65021473 missense possibly damaging 0.58
R4972:Hacd3 UTSW 9 64990436 missense probably damaging 0.99
R6174:Hacd3 UTSW 9 65005627 missense probably damaging 1.00
R7085:Hacd3 UTSW 9 64998243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACATGCTGAAATGAAATAGTG -3'
(R):5'- ATCCTGGGAGTTCTGAAGCC -3'

Sequencing Primer
(F):5'- CATGCTGAAATGAAATAGTGTTAGCC -3'
(R):5'- GGAGTTCTGAAGCCTGTCC -3'
Posted On2015-02-05