Incidental Mutation 'R3117:Man1a'
ID263101
Institutional Source Beutler Lab
Gene Symbol Man1a
Ensembl Gene ENSMUSG00000003746
Gene Namemannosidase 1, alpha
Synonymsmannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R3117 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location53904785-54076609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54030794 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 295 (M295L)
Ref Sequence ENSEMBL: ENSMUSP00000151568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003843] [ENSMUST00000105470] [ENSMUST00000218317] [ENSMUST00000220088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003843
AA Change: M204L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003843
Gene: ENSMUSG00000003746
AA Change: M204L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.6e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105469
SMART Domains Protein: ENSMUSP00000101109
Gene: ENSMUSG00000003746

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 332 2.5e-38 PFAM
coiled coil region 346 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105470
AA Change: M204L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101110
Gene: ENSMUSG00000003746
AA Change: M204L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.5e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146483
Predicted Effect possibly damaging
Transcript: ENSMUST00000218317
AA Change: M204L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000220088
AA Change: M295L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Fcho2 A C 13: 98,777,438 I217S probably damaging Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hacd3 G T 9: 64,998,309 D182E probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mlc1 T C 15: 88,976,528 D93G probably damaging Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Olfr855 A T 9: 19,584,941 I135F probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Man1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Man1a APN 10 53977013 splice site probably benign
IGL01146:Man1a APN 10 53907519 missense possibly damaging 0.90
IGL01412:Man1a APN 10 54074714 missense probably benign 0.00
IGL02009:Man1a APN 10 53925525 missense probably damaging 1.00
IGL02026:Man1a APN 10 54014473 missense probably damaging 1.00
IGL02745:Man1a APN 10 53977110 missense probably damaging 0.99
IGL02851:Man1a APN 10 53919244 missense probably damaging 1.00
IGL02929:Man1a APN 10 53925435 missense probably benign 0.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0101:Man1a UTSW 10 54075024 start codon destroyed probably null
R0200:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0463:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0947:Man1a UTSW 10 53933523 nonsense probably null
R1219:Man1a UTSW 10 53919153 splice site probably benign
R1876:Man1a UTSW 10 53919172 missense probably damaging 1.00
R2142:Man1a UTSW 10 53934998 missense probably damaging 1.00
R2219:Man1a UTSW 10 53977049 missense probably damaging 0.99
R3119:Man1a UTSW 10 54030794 missense probably damaging 0.97
R4727:Man1a UTSW 10 53907572 splice site probably null
R4942:Man1a UTSW 10 53933490 critical splice donor site probably null
R5493:Man1a UTSW 10 54074480 missense probably benign 0.25
R5921:Man1a UTSW 10 53907510 missense probably damaging 0.97
R5965:Man1a UTSW 10 53933490 critical splice donor site probably benign
R6084:Man1a UTSW 10 53919211 missense probably damaging 1.00
R6199:Man1a UTSW 10 54014456 missense possibly damaging 0.70
R6362:Man1a UTSW 10 54074795 missense probably benign 0.25
R6543:Man1a UTSW 10 53934981 nonsense probably null
R6711:Man1a UTSW 10 53933492 missense probably benign 0.00
R6982:Man1a UTSW 10 54074723 missense possibly damaging 0.92
R7061:Man1a UTSW 10 53920235 missense probably damaging 1.00
R7063:Man1a UTSW 10 54030744 missense probably damaging 1.00
R7220:Man1a UTSW 10 53920235 missense possibly damaging 0.95
R7361:Man1a UTSW 10 53908009 missense probably damaging 1.00
R7392:Man1a UTSW 10 53919187 missense probably damaging 1.00
R7566:Man1a UTSW 10 53919234 missense possibly damaging 0.93
R7864:Man1a UTSW 10 54030747 missense possibly damaging 0.88
R8338:Man1a UTSW 10 53925547 critical splice acceptor site probably null
Z1176:Man1a UTSW 10 53919315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCTAGGCTCTCTAGGA -3'
(R):5'- GTGTTCTGTTCATATCTGCCCTAA -3'

Sequencing Primer
(F):5'- GGGCTACAGAATAAGACCTTGTCTC -3'
(R):5'- ATCTGCCCTAATTTATACCATCATCC -3'
Posted On2015-02-05