Incidental Mutation 'R3117:Prpf39'
ID263104
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Namepre-mRNA processing factor 39
SynonymsSrcs1
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R3117 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65036333-65063386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65057877 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 572 (V572A)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913] [ENSMUST00000223315]
Predicted Effect probably benign
Transcript: ENSMUST00000021332
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120580
AA Change: V572A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: V572A

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220729
Predicted Effect probably benign
Transcript: ENSMUST00000220730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220957
Predicted Effect probably benign
Transcript: ENSMUST00000220983
Predicted Effect probably benign
Transcript: ENSMUST00000221166
Predicted Effect probably benign
Transcript: ENSMUST00000221608
Predicted Effect probably benign
Transcript: ENSMUST00000221913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222684
Predicted Effect probably benign
Transcript: ENSMUST00000223315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223167
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Fcho2 A C 13: 98,777,438 I217S probably damaging Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hacd3 G T 9: 64,998,309 D182E probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mlc1 T C 15: 88,976,528 D93G probably damaging Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Olfr855 A T 9: 19,584,941 I135F probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 unclassified probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8286:Prpf39 UTSW 12 65056358 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCTATGTATGCACACTGACAAC -3'
(R):5'- TGAATTACCTCCACATGTTTAGTACAC -3'

Sequencing Primer
(F):5'- TGTATGCACACTGACAACATACACG -3'
(R):5'- ACATGAGTAAGCCTGGTTACCTGC -3'
Posted On2015-02-05