Incidental Mutation 'R3117:Fcho2'
ID263106
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene NameFCH domain only 2
Synonyms
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3117 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98723403-98815449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98777438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 217 (I217S)
Ref Sequence ENSEMBL: ENSMUSP00000096883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277] [ENSMUST00000109403] [ENSMUST00000179563] [ENSMUST00000224992] [ENSMUST00000225840]
Predicted Effect probably damaging
Transcript: ENSMUST00000040340
AA Change: I217S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: I217S

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099277
AA Change: I217S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685
AA Change: I217S

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109403
AA Change: I217S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105030
Gene: ENSMUSG00000041685
AA Change: I217S

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179563
AA Change: I217S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137422
Gene: ENSMUSG00000041685
AA Change: I217S

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224231
Predicted Effect probably damaging
Transcript: ENSMUST00000224992
AA Change: I217S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225094
Predicted Effect probably damaging
Transcript: ENSMUST00000225840
AA Change: I217S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hacd3 G T 9: 64,998,309 D182E probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mlc1 T C 15: 88,976,528 D93G probably damaging Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Olfr855 A T 9: 19,584,941 I135F probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98789807 missense probably benign
IGL02058:Fcho2 APN 13 98730906 missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98730212 missense probably benign 0.08
IGL02715:Fcho2 APN 13 98796335 missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98777384 splice site probably benign
R0044:Fcho2 UTSW 13 98755544 intron probably benign
R0087:Fcho2 UTSW 13 98735086 missense probably benign 0.00
R0472:Fcho2 UTSW 13 98748267 missense probably benign 0.01
R0501:Fcho2 UTSW 13 98764515 missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98748289 missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98749850 critical splice donor site probably null
R1593:Fcho2 UTSW 13 98784807 missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98726198 missense probably benign 0.01
R1638:Fcho2 UTSW 13 98745895 missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98784816 missense probably benign 0.00
R2125:Fcho2 UTSW 13 98775898 missense possibly damaging 0.83
R3968:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R3970:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R4079:Fcho2 UTSW 13 98755612 missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98806366 missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98730891 missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98777474 missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98789802 missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98815083 missense probably benign 0.01
R6365:Fcho2 UTSW 13 98789859 missense probably benign 0.20
R7041:Fcho2 UTSW 13 98784826 missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98789463 missense probably benign
R7218:Fcho2 UTSW 13 98753613 intron probably null
R7243:Fcho2 UTSW 13 98755216 missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98784799 missense probably benign 0.00
X0018:Fcho2 UTSW 13 98732082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAGATCTAGTGCCCTCTTATG -3'
(R):5'- AAACACTGTTATCTTATGGGTCTCC -3'

Sequencing Primer
(F):5'- CCTCTTATGGCCTGCAGG -3'
(R):5'- AGACTCTGGAAAAGTTTATATTTGCC -3'
Posted On2015-02-05