Incidental Mutation 'R3117:Mlc1'
ID263107
Institutional Source Beutler Lab
Gene Symbol Mlc1
Ensembl Gene ENSMUSG00000035805
Gene Namemegalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
SynonymsWKL1, Kiaa0027-hp
MMRRC Submission 040590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3117 (G1)
Quality Score223
Status Not validated
Chromosome15
Chromosomal Location88955884-88979007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88976528 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 93 (D93G)
Ref Sequence ENSEMBL: ENSMUSP00000104993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042594] [ENSMUST00000109368]
Predicted Effect probably damaging
Transcript: ENSMUST00000042594
AA Change: D87G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047667
Gene: ENSMUSG00000035805
AA Change: D87G

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 266 288 N/A INTRINSIC
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109368
AA Change: D93G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104993
Gene: ENSMUSG00000035805
AA Change: D93G

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228970
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit myelin vacuolization that progresses with age, and show alterations in glial cell and oligodendrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AW551984 T C 9: 39,593,360 T532A probably benign Het
Dglucy A G 12: 100,838,678 S143G probably benign Het
Dlec1 G A 9: 119,143,903 probably null Het
Fcho2 A C 13: 98,777,438 I217S probably damaging Het
Filip1l T C 16: 57,506,732 S42P probably benign Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Hacd3 G T 9: 64,998,309 D182E probably damaging Het
Hsfy2 C G 1: 56,637,106 D91H probably damaging Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Myo5c G A 9: 75,266,194 probably null Het
Nlrc4 T C 17: 74,436,068 I852V probably benign Het
Notch3 C T 17: 32,158,115 C272Y probably damaging Het
Olfr855 A T 9: 19,584,941 I135F probably damaging Het
Ovgp1 T C 3: 105,986,452 probably benign Het
Pbld2 A G 10: 63,054,436 T208A probably benign Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ttc3 G A 16: 94,442,563 R1142Q possibly damaging Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Other mutations in Mlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Mlc1 APN 15 88974718 splice site probably benign
IGL03251:Mlc1 APN 15 88974731 missense possibly damaging 0.88
R0710:Mlc1 UTSW 15 88977864 missense possibly damaging 0.88
R1037:Mlc1 UTSW 15 88965461 missense probably damaging 1.00
R1573:Mlc1 UTSW 15 88958147 missense probably damaging 1.00
R1994:Mlc1 UTSW 15 88974579 missense possibly damaging 0.50
R2121:Mlc1 UTSW 15 88963431 missense probably benign 0.22
R2302:Mlc1 UTSW 15 88965437 missense possibly damaging 0.63
R3110:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3112:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R4027:Mlc1 UTSW 15 88966494 missense probably benign 0.29
R4450:Mlc1 UTSW 15 88963490 missense probably benign 0.19
R4576:Mlc1 UTSW 15 88974537 missense probably damaging 1.00
R4697:Mlc1 UTSW 15 88974777 missense probably damaging 1.00
R4728:Mlc1 UTSW 15 88978031 intron probably null
R4910:Mlc1 UTSW 15 88958212 missense possibly damaging 0.94
R5618:Mlc1 UTSW 15 88974566 missense probably damaging 1.00
R7528:Mlc1 UTSW 15 88974507 missense possibly damaging 0.95
R7746:Mlc1 UTSW 15 88964170 missense probably damaging 0.99
R7885:Mlc1 UTSW 15 88977904 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCGGATACAAGGAGCTCC -3'
(R):5'- AGCTTGCAGTCAAAGGCTGG -3'

Sequencing Primer
(F):5'- AGAAGTCCCTTGATGGCATC -3'
(R):5'- AAAGGCTGGGTGTTGTCCCC -3'
Posted On2015-02-05