Mutagenetix > Incidental Mutation

Incidental Mutation 'R3117:Filip1l'

263108

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

040590-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57506732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 42 (S42P)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099667] [ENSMUST00000114371] [ENSMUST00000159816]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099667
AA Change: S42P

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000133252
Gene: ENSMUSG00000043336
AA Change: S42P

Domain	Start	End	E-Value	Type
Pfam:CortBP2	55	201	2.6e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159816
AA Change: S42P

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: S42P

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AW551984	T	C	9: 39,593,360	T532A	probably benign	Het
Dglucy	A	G	12: 100,838,678	S143G	probably benign	Het
Dlec1	G	A	9: 119,143,903		probably null	Het
Fcho2	A	C	13: 98,777,438	I217S	probably damaging	Het
Fras1	G	A	5: 96,771,712	A3595T	probably damaging	Het
Hacd3	G	T	9: 64,998,309	D182E	probably damaging	Het
Hsfy2	C	G	1: 56,637,106	D91H	probably damaging	Het
Man1a	T	A	10: 54,030,794	M295L	probably damaging	Het
Mkrn3	CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA	CGGCATTGGCACTGGCATTGGCA	7: 62,419,214		probably benign	Het
Mlc1	T	C	15: 88,976,528	D93G	probably damaging	Het
Myo5c	G	A	9: 75,266,194		probably null	Het
Nlrc4	T	C	17: 74,436,068	I852V	probably benign	Het
Notch3	C	T	17: 32,158,115	C272Y	probably damaging	Het
Olfr855	A	T	9: 19,584,941	I135F	probably damaging	Het
Ovgp1	T	C	3: 105,986,452		probably benign	Het
Pbld2	A	G	10: 63,054,436	T208A	probably benign	Het
Prpf39	T	C	12: 65,057,877	V572A	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ttc3	G	A	16: 94,442,563	R1142Q	possibly damaging	Het
Ttc41	T	C	10: 86,724,320	M369T	possibly damaging	Het
Vwa3b	G	A	1: 37,109,077	V437I	possibly damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTAGTGCTGCTAGGGTGTAAC -3'
(R):5'- GCACACCAAATTCATAGGCAGG -3'

Sequencing Primer
(F):5'- CTGCTAGGGTGTAACAGGTAC -3'
(R):5'- ATAGGCAGGCTTCCCCTTAGATG -3'

Posted On

2015-02-05